<p>The extent of the deletions are indicated below by the red bars. The peptide coding regions (not to scale) are indicated by blue bars; one peptide coding region may extend over two exons. Flanking sequences and sizes of the deletions are as follows: <i>daf-10 flp-1(yn2)</i> (CTAAATAATTTTAAAACGTA/CTTACCTTTCAAAGTTTGCA) [<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0135164#pone.0135164.ref011" target="_blank">11</a>], <i>flp-3</i> (GCACAGCTGGAGGGTGGAGG/CAAACGATTACTATTGTGTC; 2632 bp deletion), <i>flp-4</i> (TTCTGAAAAACTTTTAATAA/AGCTCGCCGAGCCGAGTCTTG; 928 bp deletion) [<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0135164#pone.0135164.ref031" target="_blank">31</a>], <i>flp-6</i> (CAAAAAAGCGAGT...
<p>All <i>FOXL2</i> encompassing deletions were initially identified using MLPA. The regulatory dele...
<p>Micro-syntenic conservation of genomic regions containing the <i>FGF9</i>, <i>FGF20</i> and <i>FG...
<p>(A) Genomic structure of the <i>DLP</i> gene. Exons of the <i>DLP</i> gene are shown in black (co...
<p>For deletions A, 1, 5, 7 and 12, both breakpoint regions joined by the deletion are shown. These ...
<p>The ncRNA deletions are indicated by vertical black dotted lines and the direction of KanMX delet...
<p>Two isoforms of RBP2 are encoded by adjacent genes on chromosome 13, arranged head to head and tr...
<p>The top four profiles show, for each sequence position in the human GFAP DNA sequence (chr17: 429...
<p>(<b>A</b>) Molecular nature of various <i>flw</i> mutations. Genomic annotation of <i>flw</i> is ...
<div><p>(A) Genetic characterization of the <i>dop</i> genomic region. Deletion mapping identified t...
<p><b>A.</b> Scheme of the locus containing <i>PGRP-LA</i>, <i>PGRP-LC</i> and <i>PGRP-LF</i>. Each ...
<p>Overview of the <i>FOXL2</i> region (chr3:135099979–142458004; UCSC, Human Genome Browser, hg19) ...
<p>(A) Conservation plot (top) showing the average similarity score at individual amino acid positio...
<p>(A) Organization of the clusters and predicted amino acid composition of the CLP peptide chains i...
<p>Outer circle: coding DNA sequences from the AF2122/97 genome are shown in a pair of concentric ri...
<p>Boxes represent cDNA exons whose approximate codon size is indicated within. Exon boundaries and ...
<p>All <i>FOXL2</i> encompassing deletions were initially identified using MLPA. The regulatory dele...
<p>Micro-syntenic conservation of genomic regions containing the <i>FGF9</i>, <i>FGF20</i> and <i>FG...
<p>(A) Genomic structure of the <i>DLP</i> gene. Exons of the <i>DLP</i> gene are shown in black (co...
<p>For deletions A, 1, 5, 7 and 12, both breakpoint regions joined by the deletion are shown. These ...
<p>The ncRNA deletions are indicated by vertical black dotted lines and the direction of KanMX delet...
<p>Two isoforms of RBP2 are encoded by adjacent genes on chromosome 13, arranged head to head and tr...
<p>The top four profiles show, for each sequence position in the human GFAP DNA sequence (chr17: 429...
<p>(<b>A</b>) Molecular nature of various <i>flw</i> mutations. Genomic annotation of <i>flw</i> is ...
<div><p>(A) Genetic characterization of the <i>dop</i> genomic region. Deletion mapping identified t...
<p><b>A.</b> Scheme of the locus containing <i>PGRP-LA</i>, <i>PGRP-LC</i> and <i>PGRP-LF</i>. Each ...
<p>Overview of the <i>FOXL2</i> region (chr3:135099979–142458004; UCSC, Human Genome Browser, hg19) ...
<p>(A) Conservation plot (top) showing the average similarity score at individual amino acid positio...
<p>(A) Organization of the clusters and predicted amino acid composition of the CLP peptide chains i...
<p>Outer circle: coding DNA sequences from the AF2122/97 genome are shown in a pair of concentric ri...
<p>Boxes represent cDNA exons whose approximate codon size is indicated within. Exon boundaries and ...
<p>All <i>FOXL2</i> encompassing deletions were initially identified using MLPA. The regulatory dele...
<p>Micro-syntenic conservation of genomic regions containing the <i>FGF9</i>, <i>FGF20</i> and <i>FG...
<p>(A) Genomic structure of the <i>DLP</i> gene. Exons of the <i>DLP</i> gene are shown in black (co...