SUPPLEMENTAL EXPERIMENTAL PROCEDURES

(ATGCGGCCGCACTACCGCGTGGCACCAGCTCTTCCAGCACCAGGTCTTCTACC) were used to amplify nucleotides 288 through 735 while adding a thrombin cleavage site and hexa-histidine tag to make the plasmid pET24b+mpa97-245. For cloning the amino-terminal 97 amino acid truncation plasmid, primer Nde-mpa-97-ccf2 was used with Not-throm-mpa-20r (ATGCGGCCGCACTACCGCGTGGCACCAGGGTGACCAGGGTGCGGATGTAGAC). For the production of the triple mutant Mpa’’ ’ we used the Stratagene QuikChange Multi Site-Directed Mutagenesis Kit. The following three oligonucleotides with the desired mutations (underlined) were simultaneously used on the template pET24b(+)mpa2 (Darwin et al., 2005): mpaR173E (GATCCTGGCCGACGGTCATGAGGCTCTGGTCGTCGGCCAC) mpaK235E (GCCTTCGAACGCATCCCCGAAGCCGAGGTAGAAGACCTGG) mpaW187A (CGAGGAACGCGTTGTTGCGCTGGCTGATCCCCTGATCGC). The cloned PCR product was sequenced between the ATG-containing NdeI site and the mpa SacII site at ~950 bp. The NdeI-SacII site, containing all three mutations, was subcloned into the parental plasmid pET24b(+)mpa2, making pHD138. To make the triple mutated Mpa-ID, we used the same primers as above for making Mpa-ID but used pHD138 as the template. The final plasmi