The fadD22 deletion (ΔfadD22) mutant was engineered using the p2NIL/pGOAL method as reported (Parish and Stoker, 2000). A ΔfadD22 deletion cassette was constructed containing a 5´ arm (1.2-kb region upstream of fadD22 and fadD22’s start codon) and a 3 ´ arm (last ten codons of fadD22 and the downstream 810-bp segment). The C-terminal codons were preserved due to sequence overlap with pks15/1. Each arm was generated by PCR using M. bovis genomic DNA as template. Primers fadD22opL (5´-aaattcggtgctgtcaagcaaatccgcatcggcaccccaaataa-3´) and fadD22ipL (5´-gtcatccaataaatgcagctaatcgattcgattccgaacttgggaagtga-3’) were used to generate the 3 ’ arm. Primers fadD22opR (5´-agatttccagcgcaccgaatttcggtttcgaattggcggtacgca-3´) and fadD22ipR (5´-ggaatcgattagctg...
<p><b>A.</b> The mutant constructs were first amplified with two partially overlapping primers desig...
<p>(A) Schematic of the two independent point mutation sites of the <i>Pofut1</i> gene. The first mu...
A Kozak translation initiation sequence and an unique restriction enzyme site was introduced into pE...
(A) Schematic representation of the in-frame deletion strategy used to construct the exoR mutant. Pr...
<p>A. Schematic overview of the Pop-In-Pop-Out method for mutant construction. The uracil auxotrophi...
<p>(A) PCR verification of gene deletion. Lane 1, a 42,725 bp fragment was amplified using primers Z...
<p>A: <i>Foc-SIX1</i> gene deletion and replacement with an intact selectable marker gene (<i>hph</i...
Genomic regions of the Mef2c locus were isolated from 129SvEv genomic DNA by high-fidelity PCR (Roch...
(ATGCGGCCGCACTACCGCGTGGCACCAGCTCTTCCAGCACCAGGTCTTCTACC) were used to amplify nucleotides 288 through...
Plasmid constructions and cell growth- The construction of pHL414-2 has been described previously (L...
Standard molecular biology techniques were used for cloning (Sambrook, 2001). The structures of all ...
Plasmid pRJ741 (pG14-prGPD1-MS2CP-RedStar) was constructed by ligating pG14-GPD1-MS2CP-GFP [S1], whi...
C-terminally truncated PBP2 was constructed by a PCR based approach to delete the C-terminal fragmen...
et al. 2007). pBabeSOCS1 and pBabeSOCS1ΔBox were obtained from Dr I. Touw. pLPCMyc-tagged SOCS1 was ...
<p>(A) Targeting construct. Dark boxes: Exons; dark triangles: loxP sites. A mcl-neo cassette flanke...
<p><b>A.</b> The mutant constructs were first amplified with two partially overlapping primers desig...
<p>(A) Schematic of the two independent point mutation sites of the <i>Pofut1</i> gene. The first mu...
A Kozak translation initiation sequence and an unique restriction enzyme site was introduced into pE...
(A) Schematic representation of the in-frame deletion strategy used to construct the exoR mutant. Pr...
<p>A. Schematic overview of the Pop-In-Pop-Out method for mutant construction. The uracil auxotrophi...
<p>(A) PCR verification of gene deletion. Lane 1, a 42,725 bp fragment was amplified using primers Z...
<p>A: <i>Foc-SIX1</i> gene deletion and replacement with an intact selectable marker gene (<i>hph</i...
Genomic regions of the Mef2c locus were isolated from 129SvEv genomic DNA by high-fidelity PCR (Roch...
(ATGCGGCCGCACTACCGCGTGGCACCAGCTCTTCCAGCACCAGGTCTTCTACC) were used to amplify nucleotides 288 through...
Plasmid constructions and cell growth- The construction of pHL414-2 has been described previously (L...
Standard molecular biology techniques were used for cloning (Sambrook, 2001). The structures of all ...
Plasmid pRJ741 (pG14-prGPD1-MS2CP-RedStar) was constructed by ligating pG14-GPD1-MS2CP-GFP [S1], whi...
C-terminally truncated PBP2 was constructed by a PCR based approach to delete the C-terminal fragmen...
et al. 2007). pBabeSOCS1 and pBabeSOCS1ΔBox were obtained from Dr I. Touw. pLPCMyc-tagged SOCS1 was ...
<p>(A) Targeting construct. Dark boxes: Exons; dark triangles: loxP sites. A mcl-neo cassette flanke...
<p><b>A.</b> The mutant constructs were first amplified with two partially overlapping primers desig...
<p>(A) Schematic of the two independent point mutation sites of the <i>Pofut1</i> gene. The first mu...
A Kozak translation initiation sequence and an unique restriction enzyme site was introduced into pE...