Add to ORKG(Langley et al., 2002). The plasmid encoding Myc-NBS1mt was generated using the QuickChange Site-Directed Mutagenesis kit following the manufacturer’s protocol (Stratagene). Plasmids encoding GST-NBS1 deletion mutants were created by inserting PCR products of NBS1 fragments into Bam H1/Not 1 digested pGEX-5X-1 vectors (Amersham). pBS/U6-SIRT1 was constructed by inserting oligodeoxynucleotides, which targeted the sequence 5’GAAGTTGACCTCCTCATTGT3 ’ into the pBS/U6 vector (Sui et al., 2002). SIRT1 siRNA and control siRNA adenoviruses were described previously (Rodgers et al., 2005). Plasmids that express Myc-tagged NBS1 lysine to glutamine mutants (5KQ: K544Q/K665Q/K690Q/K698Q/K715Q; 7KQ: K441Q/K504Q/K544Q/K665Q/K690Q/K698Q/K715Q; 9KQ: K233Q/K...
The following plasmids were used for the generation of retroviruses: pBabe (Morgenstern and Land, 19...
Plasmid pRJ741 (pG14-prGPD1-MS2CP-RedStar) was constructed by ligating pG14-GPD1-MS2CP-GFP [S1], whi...
described previously. The GST-Rho39 expression vector was constructed by transferring the sequence e...
Based on cDNAs BC016121 and NM_133931 (Baumann et al., 2002), we used a PCR strategy to clone the Po...
Standard molecular biology techniques were used for cloning (Sambrook, 2001). The structures of all ...
The targeting construct used plasmid PLN-TK as backbone (Gorman et al., 1996). Targeting arms were g...
tained by PCR, sequenced, and cloned into pCMUIV vector [S1]. Dominant-negative Rab11A S25N and Rab4...
Several plasmids used in this study have previously been described. They include the expression plas...
oligo: 5′-TGTCACTTCTCACACC*A*A*) were purchased from BioSource (Camarillo, CA). Tctex-1 siRNA oligon...
et al. 2007). pBabeSOCS1 and pBabeSOCS1ΔBox were obtained from Dr I. Touw. pLPCMyc-tagged SOCS1 was ...
Genomic DNA clones used in the construction of all 3 mouse lines were isolated from the 129/Svj mous...
were cloned into the D277mGFP6 vector [S1]. Mutations were intro-duced into the PAR-1 UBA domain (KR...
were generated by homologous recombination in embryonic stem cells. Sequences used for the generatio...
The methyl-K79-specific antibody was raised by injection of rabbits with a synthetic peptide coding ...
The plasmids encoding myc-tagged Raptor, and HA-tagged S6K1 and RSK1-4 were previously described [1-...
The following plasmids were used for the generation of retroviruses: pBabe (Morgenstern and Land, 19...
Plasmid pRJ741 (pG14-prGPD1-MS2CP-RedStar) was constructed by ligating pG14-GPD1-MS2CP-GFP [S1], whi...
described previously. The GST-Rho39 expression vector was constructed by transferring the sequence e...
Based on cDNAs BC016121 and NM_133931 (Baumann et al., 2002), we used a PCR strategy to clone the Po...
Standard molecular biology techniques were used for cloning (Sambrook, 2001). The structures of all ...
The targeting construct used plasmid PLN-TK as backbone (Gorman et al., 1996). Targeting arms were g...
tained by PCR, sequenced, and cloned into pCMUIV vector [S1]. Dominant-negative Rab11A S25N and Rab4...
Several plasmids used in this study have previously been described. They include the expression plas...
oligo: 5′-TGTCACTTCTCACACC*A*A*) were purchased from BioSource (Camarillo, CA). Tctex-1 siRNA oligon...
et al. 2007). pBabeSOCS1 and pBabeSOCS1ΔBox were obtained from Dr I. Touw. pLPCMyc-tagged SOCS1 was ...
Genomic DNA clones used in the construction of all 3 mouse lines were isolated from the 129/Svj mous...
were cloned into the D277mGFP6 vector [S1]. Mutations were intro-duced into the PAR-1 UBA domain (KR...
were generated by homologous recombination in embryonic stem cells. Sequences used for the generatio...
The methyl-K79-specific antibody was raised by injection of rabbits with a synthetic peptide coding ...
The plasmids encoding myc-tagged Raptor, and HA-tagged S6K1 and RSK1-4 were previously described [1-...
The following plasmids were used for the generation of retroviruses: pBabe (Morgenstern and Land, 19...
Plasmid pRJ741 (pG14-prGPD1-MS2CP-RedStar) was constructed by ligating pG14-GPD1-MS2CP-GFP [S1], whi...
described previously. The GST-Rho39 expression vector was constructed by transferring the sequence e...