Ask
Search
My library
ORKG

ORKG Ask

Our mission is to organize scholarly knowledge and make it accessible to humans and machines.

About

About ORKG Ask
Report issue
Statistics
Contact

Legal

Terms of use
Data protection (sheet)
Imprint
Accessibility
License

Technical

We
open source
System status
Changelog
Frontend: v1.41.0
Backend: v1.13.4

We use cookies to provide a better user experience.

Data Protection

shRNA constructs used in this study.

Ching-Yu Yen (745624)
Wei-Fan Chiang (745625)
Shyun-Yeu Liu (745626)
Chung-Chih Lin (202032)
Kuo-An Liao (745627)
Che-Yi Lin (218292)
Wan-Fang Hsieh (745628)
Yon-Chi Cheng (745629)
Kai-Cheng Hsu (177095)
Pin-Yen Lin (745630)
Tai-Chi Chen (745631)
I-Ling Lee (188654)
Mei-Huei Lin (745632)
Young-Chau Liu (202045)

Publication date

May 2015

DOI

10.1371/journal.pone.0128011.t001

Abstract

<p><sup>1</sup>The complementary sequences of shRNA were underlined.</p><p>shRNA constructs used in this study.</p

Extracted data

Related items

The shRNA loop co-determine shRNA efficacy.

Stig Mølgaard Rask Jensen (310981)
Alexander Schmitz (222922)
Finn Skou Pedersen (33280)
Jørgen Kjems (195388)
Jesper Bertram Bramsen (247833)

February 2013

<p><b>A</b>. Schematic representation of the shRNA-loop selection experiment. DNA fragments encoding...

Sequences of positive standards used in this study, primer and probe binding regions are depicted in capitals.

Kerstin Wernike (316670)
Bernd Hoffmann (191620)
Malte Dauber (317225)
Elke Lange (317227)
Horst Schirrmeier (288813)
Martin Beer (222377)

February 2013

<p>Sequences of positive standards used in this study, primer and probe binding regions are depicted...

Sequences of the identified shRNA clones.

Shen Pang (564873)
Lauren Pokomo (564874)
Kevin Chen (264284)
Masakazu Kamata (106613)
Si-Hua Mao (564875)
Hong Zhang (25820)
Elliot Razi (564876)
Dong Sung An (106609)
Irvin S. Y. Chen (106611)

May 2014

<p>*B12 and H5 are identical to F8, and D9 is identical to D11.</p>#<p>H3 is similar to Dharmacon se...

Analysis of sequences of enriched shRNA.

John S. Cho (120260)
Yun C. Kim (370586)
Sherie L. Morrison (369235)

February 2013

<p>(A) Pie chart representing the frequency of shRNA occurrence among the 140 clones sequenced. 2-3X...

Sequences of RNAi and shRNA used for this study to knock down <i>Kif5b</i> and control.

Dawit Kidane (19071)
Denny Sakkas (396932)
Timothy Nottoli (396933)
James McGrath (396934)
Joann B. Sweasy (31229)

April 2013

<p>Sequences of RNAi and shRNA used for this study to knock down <i>Kif5b</i> and control.</p

Primers used in this study.

Yueqiang Leng (276522)
Shaobin Zhong (4258)

May 2015

<p>*Underlined sequences are complementary to M13F and M13R sequences, respectively.</p><p>Primers u...

The effects of various loop sequences on shRNA silencing activity.

Xue-jun Wang (280169)
Ying Li (38224)
Hai Huang (140371)
Xiu-juan Zhang (280170)
Pei-wen Xie (280171)
Wei Hu (6560)
Dan-dan Li (1882417)
Sheng-qi Wang (2457040)

February 2013

<p>(A) An shRNA scaffold targeted to the HBV conserved sequence “GGUAUGUUGCCCGUUUGUCCU” reported pre...

shRNA sense strand sequences for <i>Mef2a</i> mRNA and negative control in this study.

Ya-Ning Wang (4537276)
Wu-Cai Yang (5146793)
Pei-Wei Li (5146796)
Hong-Bao Wang (32375)
Ying-Ying Zhang (586673)
Lin-Sen Zan (453211)

April 2018

<p>shRNA sense strand sequences for <i>Mef2a</i> mRNA and negative control in this study.</p

Comparison of the two shRNA construction methods.

Xue-jun Wang (280169)
Ying Li (38224)
Hai Huang (140371)
Xiu-juan Zhang (280170)
Pei-wen Xie (280171)
Wei Hu (6560)
Dan-dan Li (1882417)
Sheng-qi Wang (2457040)

February 2013

<p>(A) The shRNA clone method based on one long oligonucleotide (MO). The oligo underlined was synth...

Constructs used in this study.

Nicolas Jullien (82773)
Catherine Roche (714860)
Thierry Brue (341760)
Dominique Figarella-Branger (33963)
Thomas Graillon (714861)
Anne Barlier (490235)
Jean-Paul Herman (82778)

March 2015

<p>A. Oligonucleotides used for the construction of the shRNA expressing lentiviral vectors. In red ...

Sequences of primers used for PCR, sequencing and Real-Time PCR, followed by sequences of a TaqMan probe, shRNAs, and CRNDEP epitopes used in the present study.

Lukasz Michal Szafron (740177)
Anna Balcerak (740178)
Ewa Anna Grzybowska (740179)
Barbara Pienkowska-Grela (740180)
Anna Felisiak-Golabek (740181)
Agnieszka Podgorska (740182)
Magdalena Kulesza (740183)
Natalia Nowak (740184)
Pawel Pomorski (223458)
Juliusz Wysocki (740185)
Tymon Rubel (240598)
Agnieszka Dansonka-Mieszkowska (740186)
Bozena Konopka (740187)
Martyna Lukasik (740188)
Jolanta Kupryjanczyk (740189)

May 2015

<p><sup>1</sup>) Restriction enzyme recognition sites inserted in primer overhangs were <u>underline...

List of shRNA vectors that were selected by the criteria as in figure 1c. Depicted are shRNAs that were used in validation experiments.

Jasper Mullenders (373998)
Armida W. M. Fabius (373999)
Mandy Madiredjo (374000)
René Bernards (82847)
Roderick L. Beijersbergen (203726)

February 2013

<p>Under rescue; + means a validated shRNA, − means not validated. <i>M</i> indicates the <sup>2</su...

Sequence of primers used in the study to amplification segments for analysis of each SNP.

Mónica Alexandra Bustos (14725057)
Luz Dary Castañeda-Castañeda (14725060)
Carmen Rosa Acosta (14725063)
Diana García (14725066)
Diana Patricia Bohada (14725069)
Raúl Rodríguez (830321)
Martha Inírida Guerrero (13117365)

March 2023

Sequence of primers used in the study to amplification segments for analysis of each SNP.</p

Two sequence motifs from intergenic ncRNAs with significant similarity against known DNA motifs.

Zhipeng Qu (110511)
David L. Adelson (110514)

August 2012

<p>For each comparison, the upper one is the known DNA motif, and the lower one is the intergenic nc...

Primer Sequences.

Bijal A. Parikh (683645)
Diana L. Beckman (683646)
Swapneel J. Patel (683647)
J. Michael White (683648)
Wayne M. Yokoyama (116349)

January 2015

<p>Primer sequences for sgRNA synthesis, sequencing, and mutagenesis are shown.</p><p>Primer Sequenc...

The shRNA loop co-determine shRNA efficacy.

Stig Mølgaard Rask Jensen (310981)
Alexander Schmitz (222922)
Finn Skou Pedersen (33280)
Jørgen Kjems (195388)
Jesper Bertram Bramsen (247833)

February 2013

<p><b>A</b>. Schematic representation of the shRNA-loop selection experiment. DNA fragments encoding...

Sequences of positive standards used in this study, primer and probe binding regions are depicted in capitals.

Kerstin Wernike (316670)
Bernd Hoffmann (191620)
Malte Dauber (317225)
Elke Lange (317227)
Horst Schirrmeier (288813)
Martin Beer (222377)

February 2013

<p>Sequences of positive standards used in this study, primer and probe binding regions are depicted...

Sequences of the identified shRNA clones.

Shen Pang (564873)
Lauren Pokomo (564874)
Kevin Chen (264284)
Masakazu Kamata (106613)
Si-Hua Mao (564875)
Hong Zhang (25820)
Elliot Razi (564876)
Dong Sung An (106609)
Irvin S. Y. Chen (106611)

May 2014

<p>*B12 and H5 are identical to F8, and D9 is identical to D11.</p>#<p>H3 is similar to Dharmacon se...

Analysis of sequences of enriched shRNA.

John S. Cho (120260)
Yun C. Kim (370586)
Sherie L. Morrison (369235)

February 2013

<p>(A) Pie chart representing the frequency of shRNA occurrence among the 140 clones sequenced. 2-3X...

Sequences of RNAi and shRNA used for this study to knock down <i>Kif5b</i> and control.

Dawit Kidane (19071)
Denny Sakkas (396932)
Timothy Nottoli (396933)
James McGrath (396934)
Joann B. Sweasy (31229)

April 2013

<p>Sequences of RNAi and shRNA used for this study to knock down <i>Kif5b</i> and control.</p

Primers used in this study.

Yueqiang Leng (276522)
Shaobin Zhong (4258)

May 2015

<p>*Underlined sequences are complementary to M13F and M13R sequences, respectively.</p><p>Primers u...

The effects of various loop sequences on shRNA silencing activity.

Xue-jun Wang (280169)
Ying Li (38224)
Hai Huang (140371)
Xiu-juan Zhang (280170)
Pei-wen Xie (280171)
Wei Hu (6560)
Dan-dan Li (1882417)
Sheng-qi Wang (2457040)

February 2013

<p>(A) An shRNA scaffold targeted to the HBV conserved sequence “GGUAUGUUGCCCGUUUGUCCU” reported pre...

shRNA sense strand sequences for <i>Mef2a</i> mRNA and negative control in this study.

Ya-Ning Wang (4537276)
Wu-Cai Yang (5146793)
Pei-Wei Li (5146796)
Hong-Bao Wang (32375)
Ying-Ying Zhang (586673)
Lin-Sen Zan (453211)

April 2018

<p>shRNA sense strand sequences for <i>Mef2a</i> mRNA and negative control in this study.</p

Comparison of the two shRNA construction methods.

Xue-jun Wang (280169)
Ying Li (38224)
Hai Huang (140371)
Xiu-juan Zhang (280170)
Pei-wen Xie (280171)
Wei Hu (6560)
Dan-dan Li (1882417)
Sheng-qi Wang (2457040)

February 2013

<p>(A) The shRNA clone method based on one long oligonucleotide (MO). The oligo underlined was synth...

Constructs used in this study.

Nicolas Jullien (82773)
Catherine Roche (714860)
Thierry Brue (341760)
Dominique Figarella-Branger (33963)
Thomas Graillon (714861)
Anne Barlier (490235)
Jean-Paul Herman (82778)

March 2015

<p>A. Oligonucleotides used for the construction of the shRNA expressing lentiviral vectors. In red ...

Sequences of primers used for PCR, sequencing and Real-Time PCR, followed by sequences of a TaqMan probe, shRNAs, and CRNDEP epitopes used in the present study.

Lukasz Michal Szafron (740177)
Anna Balcerak (740178)
Ewa Anna Grzybowska (740179)
Barbara Pienkowska-Grela (740180)
Anna Felisiak-Golabek (740181)
Agnieszka Podgorska (740182)
Magdalena Kulesza (740183)
Natalia Nowak (740184)
Pawel Pomorski (223458)
Juliusz Wysocki (740185)
Tymon Rubel (240598)
Agnieszka Dansonka-Mieszkowska (740186)
Bozena Konopka (740187)
Martyna Lukasik (740188)
Jolanta Kupryjanczyk (740189)

May 2015

<p><sup>1</sup>) Restriction enzyme recognition sites inserted in primer overhangs were <u>underline...

List of shRNA vectors that were selected by the criteria as in figure 1c. Depicted are shRNAs that were used in validation experiments.

Jasper Mullenders (373998)
Armida W. M. Fabius (373999)
Mandy Madiredjo (374000)
René Bernards (82847)
Roderick L. Beijersbergen (203726)

February 2013

<p>Under rescue; + means a validated shRNA, − means not validated. <i>M</i> indicates the <sup>2</su...

Sequence of primers used in the study to amplification segments for analysis of each SNP.

Mónica Alexandra Bustos (14725057)
Luz Dary Castañeda-Castañeda (14725060)
Carmen Rosa Acosta (14725063)
Diana García (14725066)
Diana Patricia Bohada (14725069)
Raúl Rodríguez (830321)
Martha Inírida Guerrero (13117365)

March 2023

Sequence of primers used in the study to amplification segments for analysis of each SNP.</p

Two sequence motifs from intergenic ncRNAs with significant similarity against known DNA motifs.

Zhipeng Qu (110511)
David L. Adelson (110514)

August 2012

<p>For each comparison, the upper one is the known DNA motif, and the lower one is the intergenic nc...

Primer Sequences.

Bijal A. Parikh (683645)
Diana L. Beckman (683646)
Swapneel J. Patel (683647)
J. Michael White (683648)
Wayne M. Yokoyama (116349)

January 2015

<p>Primer sequences for sgRNA synthesis, sequencing, and mutagenesis are shown.</p><p>Primer Sequenc...

The shRNA loop co-determine shRNA efficacy.

Stig Mølgaard Rask Jensen (310981)
Alexander Schmitz (222922)
Finn Skou Pedersen (33280)
Jørgen Kjems (195388)
Jesper Bertram Bramsen (247833)

February 2013

<p><b>A</b>. Schematic representation of the shRNA-loop selection experiment. DNA fragments encoding...

Sequences of positive standards used in this study, primer and probe binding regions are depicted in capitals.

Kerstin Wernike (316670)
Bernd Hoffmann (191620)
Malte Dauber (317225)
Elke Lange (317227)
Horst Schirrmeier (288813)
Martin Beer (222377)

February 2013

<p>Sequences of positive standards used in this study, primer and probe binding regions are depicted...

Sequences of the identified shRNA clones.

Shen Pang (564873)
Lauren Pokomo (564874)
Kevin Chen (264284)
Masakazu Kamata (106613)
Si-Hua Mao (564875)
Hong Zhang (25820)
Elliot Razi (564876)
Dong Sung An (106609)
Irvin S. Y. Chen (106611)

May 2014

<p>*B12 and H5 are identical to F8, and D9 is identical to D11.</p>#<p>H3 is similar to Dharmacon se...