Distribution of aligned reads on the reference rDNA sequence.

<p>This figure shows the count distribution of all aligned reads on the reference rDNA sequence (Genbank: AF291874.1). This rDNA sequence is from the sense strand of DNA. ITS1 and ITS2 represents the internal transcribed spacer 1 and the internal transcribed spacer 2. Two extremely abundant sRNAs (TATTGAGGCTTAGCCTCTGACTGGAAGGTTTGT and GAGGCTTAGCCTCTGACTGGAAGGTTTGT) were not used to plot this figure to avoid the bias brought by the possible PCR duplication.