S1Supplemental Data MutS Binds to and Promotes Synapsis of Transcriptionally Activated Immunoglobulin Switch Regions

overnight with 5 g of anti-MSH2 antibodies, purified IgG, or poly-clonal anti-acetyl-histone H4 antibodies (Upstate Biotechnology).Chromatin Immunoprecipitation Experimental precedents suggested that significant levels of enrich- Re-ChIP was performed as described [S9, S10] with somemodifica-tions. After the first IP, protein-DNA complexes were eluted by incu-ment of recombination factors at specific genomic regions could be observed by chromatin immunoprecipitation (ChIP) but that the bation at 37C in 10 mM DTT diluted 1:50 in dilution buffer (40 mM Tris [pH 8.1], 4 mM EDTA, 300 mM NaCl, 10mM sodium butyrate,magnitude of enrichment might not be high (e.g., [S6]). The ChIP analysis was therefore designed with internal controls for specificity and 1 % Triton X-100), and the second IPs were performed with 5 g of one of two rabbit polyclonal anti-MSH2 antibodies or withof IP and recovery and amplification efficiency of DNA to ensure reliability. ChIPs were carried out in parallel with two different anti- purified IgG as a control, as described above. For all IP experiments, eluted DNA was amplified in 50 l reactions containing 1 Ci 32P-MSH2 antibodies, raised either against an N-terminal peptide (Santa Cruz Biotechnology, Santa Cruz, CA) or full-length recombinant pro- dCTP (NEN). Products were resolved on a 4 % polyacrylamide gel and quantified onMolecular Dynamics phosphoimager. The primerstein (Oncogene Research Products, San Diego, CA) or with purified IgG from nonimmunized rabbits (Upstate Biotechnology, Waltham, used to amplify S3wereGGGAGCTGGGGTAGGTTCAAGTATGand CTGCCCAGCCTGGTCCTCACAA [S11]. The primers used to amplifyMA). Sequences from the S3 regions and the ubiquitously ex-pressed triosephosphate isomerase (TPI) gene were coamplified by murine TPI were CTCAACTGTCGAGCCACTGA and GTACAAAC