<span style="color: #29363d; font-family: Tahoma, Arial, Helvetica, sans-serif; font-size: 14.666666984558105px; font-style: italic; text-align: justify; background-color: #ddeaf4;">A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTACGGTGC-3’ (backward). A single band of 300 bp which was specific for can...
A presença do vírus da cinomose canina (CDV) foi avaliada pela reação em cadeia da polimerase, prece...
Abstract Background Canine distemper virus (CDV) is present worldwide and produces a lethal systemic...
Empregou-se a técnica de reação em cadeia pela polimerase precedida de transcrição reversa para dete...
Canine Distemper have become a major concern within the veterinary clinical work. Thus, the appearan...
Canine distemper virus is the etiological agent of a severe disease in dogs and many other carnivore...
Abstract Background Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious...
Canine distemper virus (CDV) is a member of genus Morbillivirus and family Paramyxoviridae that have...
Canine distemper is a highly contagious disease affecting dogs worldwide, often inducing severe neur...
A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-...
Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. The unp...
Urine and leucocytes were comparatively evaluated as clinical samples for ante mortem detection of t...
Worldwide, Canine Distemper Virus (CDV) infection is a highly prevalent disease with high morbidity ...
ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Ca...
none5Canine distemper virus is the causative agent of a high lethality rate disease affecting dogs w...
O vírus da cinomose canina (VCC) é um patógeno viral, altamente, contagioso que pode causar doença s...
A presença do vírus da cinomose canina (CDV) foi avaliada pela reação em cadeia da polimerase, prece...
Abstract Background Canine distemper virus (CDV) is present worldwide and produces a lethal systemic...
Empregou-se a técnica de reação em cadeia pela polimerase precedida de transcrição reversa para dete...
Canine Distemper have become a major concern within the veterinary clinical work. Thus, the appearan...
Canine distemper virus is the etiological agent of a severe disease in dogs and many other carnivore...
Abstract Background Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious...
Canine distemper virus (CDV) is a member of genus Morbillivirus and family Paramyxoviridae that have...
Canine distemper is a highly contagious disease affecting dogs worldwide, often inducing severe neur...
A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-...
Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. The unp...
Urine and leucocytes were comparatively evaluated as clinical samples for ante mortem detection of t...
Worldwide, Canine Distemper Virus (CDV) infection is a highly prevalent disease with high morbidity ...
ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Ca...
none5Canine distemper virus is the causative agent of a high lethality rate disease affecting dogs w...
O vírus da cinomose canina (VCC) é um patógeno viral, altamente, contagioso que pode causar doença s...
A presença do vírus da cinomose canina (CDV) foi avaliada pela reação em cadeia da polimerase, prece...
Abstract Background Canine distemper virus (CDV) is present worldwide and produces a lethal systemic...
Empregou-se a técnica de reação em cadeia pela polimerase precedida de transcrição reversa para dete...