AbstractThe product from the in vitro transcription of native λDNA by purified E. coli RNA polymerase does not stimulate total amino acid incorporation although it can program ribosomes for the first peptide bond synthesis in the presence of the three initiation factor A, B and C
Until now, three initiation pathways for ribosomal protein synthesis have been described: the 30S-bi...
Transcription initiation has long been assumed to be a sequence composed of four steps: binding of R...
<p>RNA primer was synthesized by p48/p58 primase in the absence or presence of Mcm and/or GINS compl...
AbstractThe product from the in vitro transcription of native λDNA by purified E. coli RNA polymeras...
AbstractThree 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAAC...
The order of addition of amino acids to a growing protein is determined by the codon sequence of a m...
Various aspects of protein synthesis have been studied, both to gain insight into its mechanism and ...
Cell-free coupled transcription–translation systems with bacterial lysates are widely used to synthe...
International audiencetmRNA (SsrA or 10Sa RNA) functions as both a transfer RNA and a messenger RNA,...
Formylation of initiator methionyl-tRNA is essential for normal growth of eubacteria. However, under...
International audienceIn all organisms, translational initiation takes place on the small ribosomal ...
CSIRTranslation initiation is a rate limiting step during protein biosynthesis. Initiation occurs by...
Eukaryotic cellular mRNA is believed to be synthesized exclusively by RNA polymerase II (pol II), wh...
AbstractTernary RNA-dependent RNA polymerase complexes were arrested at various stages of synthesisi...
AbstractMisacylated phenylalanyl-tRNALys, just as lysyl-tRNALys, but not phenylalanyl-tRNAPhe, have ...
Until now, three initiation pathways for ribosomal protein synthesis have been described: the 30S-bi...
Transcription initiation has long been assumed to be a sequence composed of four steps: binding of R...
<p>RNA primer was synthesized by p48/p58 primase in the absence or presence of Mcm and/or GINS compl...
AbstractThe product from the in vitro transcription of native λDNA by purified E. coli RNA polymeras...
AbstractThree 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAAC...
The order of addition of amino acids to a growing protein is determined by the codon sequence of a m...
Various aspects of protein synthesis have been studied, both to gain insight into its mechanism and ...
Cell-free coupled transcription–translation systems with bacterial lysates are widely used to synthe...
International audiencetmRNA (SsrA or 10Sa RNA) functions as both a transfer RNA and a messenger RNA,...
Formylation of initiator methionyl-tRNA is essential for normal growth of eubacteria. However, under...
International audienceIn all organisms, translational initiation takes place on the small ribosomal ...
CSIRTranslation initiation is a rate limiting step during protein biosynthesis. Initiation occurs by...
Eukaryotic cellular mRNA is believed to be synthesized exclusively by RNA polymerase II (pol II), wh...
AbstractTernary RNA-dependent RNA polymerase complexes were arrested at various stages of synthesisi...
AbstractMisacylated phenylalanyl-tRNALys, just as lysyl-tRNALys, but not phenylalanyl-tRNAPhe, have ...
Until now, three initiation pathways for ribosomal protein synthesis have been described: the 30S-bi...
Transcription initiation has long been assumed to be a sequence composed of four steps: binding of R...
<p>RNA primer was synthesized by p48/p58 primase in the absence or presence of Mcm and/or GINS compl...