The nucleotide sequence of chloroplast 4.5 S rRNA from Mnium rugicum (Bryophyta) : mosses also possess this type of RNA
- Troitsky, A.V.
- Bobrova, V.K.
- Ponomarev, A.G.
- Antonov, A.S.
Publication date
October 1984
DOI Publisher
Published by Elsevier B.V. ISSN
0014-5793 Citation count (estimate)
11Abstract
AbstractThe complete nucleotide sequence of chloroplast 4.5 S rRNA from the moss Mnium rugicum was determined to be OHUAAGGUGACGGCAAGACUAGCCGUUUAUCAUCACGAUAGGUGCCAAGUGGAAGUGCAGUAAUGUAUGCAGCUGAGGCAUCCUAACAGACCGAGAGAUUUAAACOH. The sequence differs from that of a fern Dryopteris acuminata and of angiosperms 4.5 S rRNA by 8 and 9–14%, respectively. The strong conservation of 4.5 S rRNA in the course of evolution ensures its use for reconstruction of the phylogenetic relations between the higher taxa of plants
Add to ORKG