In Vivo Modulation of Bacillus Subtilis Sub Specie for High Level Production of Thermo-Stable Amylase

In Vivo Modulation of Bacillus Subtilis Sub Specie for High Level Production of Thermo-Stable Amylase Emoleila Itoandon1, Femi Adams 2, Olawale Lasore 3, Oluwagbenga Shobowale4, Celestina Oje5, Ferdinard Okougha6, Georgina Ananso7 1, 3, 5 Department of Biotechnology, Federal Institute of Industrial Research, Lagos state, Nigeria, 2 Department of Analytical Services, Federal Institute of Industrial Research, Lagos state, Nigeria. 4 Supreme Education Foundation, Magodo, Lagos, Nigeria. 6,7 Science Laboratory Technology and Research Department, Nigerian Building and Road Research Institute, Ogun state, Nigeria. emoleila.itoadon@fiiro.gov.ng, itoandonemoleila@gmail.com, olawalelasore@gmail.com, celestinaakuma@gmail.com, dudusapril@gmail.com, shobowalegbenga@yahoo.com, ferdinandokougha@gmail.com, georginaananso@yahoo.com IJBST (2019), 12(1):1-12 ABSTRACT The aim of the investigation was to construct a plasmid-DNA inserted into an empty Bacillus subtilis host for growth stability and synthesis of thermo-stable amylase. The method of in vivo modification described as follows: (1). Construct of 5’ – 3’ forward primer (AAGGAGACGCGTATGTTTGCAAAACGATTCAAAACC) and 3’ – 5’ reverse primer (ATGTGATCTAGAATGGGGAAGAGAACCGCTTAAG), (2). Use the primers to amplify a target regions of a mesophilic Bacillus subtilis 16s sequence obtained from National Centre for Biotechnology Information (NCBI) data, (3). Infusion cloning of aprE signal peptide bond with amplified amylase gene inserted a pBE-S-DNA vector and finally (4). Production and characterization of amylase using new Bacillus construct. The newly constructed Bacillus subtilis sub specie was compared to a commercial Bacillus subtilis to ascertain improved expression in conditions. The results showed growth of Bacillus subtilis sub specie at 52oC while commercial Bacillus subtilis was stable at 37oC. Submerged fermentation was used for production of amylase using starch as substrate. Amylase activities of 5.2 U/ml was obtained at 60oC and 4.3 U/ml at pH 6.0 by Bacillus subtilis sub-specie while activities of 4.3 U/ml at 50oC and 3.4 U/ml at pH 7.0 by commercial strain respectively. The crude enzyme samples were partially purified by 70% ammonium sulphate precipitation and their molecular weights were determined using sodium dodecyl sulphate – polyacrylamide gel electrophoresis (SDS-PAGE). The weight of amylase sample by constructed Bacillus subtilis sub specie was observed to be in the range of 75 - 77KDa while sample of commercial Bacillus subtilis was in the range of 65 - 70kDa. In conclusion, in vivo modification technique proved to be useful in gene regulation and in this study developing a high active strain for synthesis of thermo-stable amylase. Further work on regulation of the amino acids positioning, developing cocktail of promoters and activation of microbial signaling are possible research targets that can influence properties of peptide bonds for optimal amylase functionality in industries. Keywords: Bacillus, Signal Peptide bond, Submerged, Amylase, Thermostability, URL: https://www.ijbst.org/papers-published/ijbst-2019-volume-12-issue-