Amelogênese imperfeita autossômica recessiva : aspectos clínicos e genéticos

Dissertação (mestrado) — Universidade de Brasília, Faculdade de Ciências da Saúde, Programa de Pós-Graduação em Ciências da Saúde, 2022.A amelogênese imperfeita (AI) é uma condição genética caracterizada por alterações quantitativas e/ou qualitativas do esmalte dentário. A AI pode manifestar-se de forma isolada ou como manifestação de alguma síndrome. Nos últimos anos, variantes em 26 genes foram identificadas em casos de AI. O objetivo deste estudo foi realizar a caracterização clínica e diagnóstico molecular de cinco famílias com hipótese diagnóstica de AI autossômica recessiva (AIAR) em acompanhamento no Centro de Atendimento Odontológico de Doenças Raras, do Hospital Universitário de Brasília. Foram avaliados prontuários clínicos, coletado sangue de pacientes e familiares para extração de DNA pelo método salting out, e enviado para o sequenciamento de exoma. Novas variantes foram validadas por sequenciamento Sanger. Os sequenciamentos foram analisados nas plataformas Varstation® de Varsomics e Franklin, Genoox. Foram identificadas variantes bialélicas ou em homozigose em 3 diferentes genes. Variantes em homozigose no gene RELT foram identificadas em duas irmãs com AI isolada (c.120+1G>A,p.?); Dois pacientes com hipótese diagnóstica de Síndrome Esmalte Renal (ERS) apresentaram variantes no gene FAM20A, (c.343_362delTCGCTCCTGGCCAGCCAGGA, p. Ser115Glyfs*48 e c.406C>T, p. Arg136*; c.1112G>A, p. Trp371*); Uma paciente com hipótese diagnóstica de Anomalias dentárias e baixa estatura apresentou duas variantes no gene LTBP3 (c.85_105delCTGCTGCTGCTGCTGCTGCTG, p. Leu29_Leu35del; c.3214C>T, p. Gln1072Ter) ; e em um paciente não foi identificado variantes patogênicas em genes associadas a AI. Os resultados desse estudo ampliam o conhecimento do fenótipo orodental de pacientes com amelogênese imperfeita autossômica recessiva isolada e sindrômica no Distrito Federal e do espectro de variantes nos genes LTBP3, FAM20A e RELT. Além disso, evidenciam a importância da caracterização fenotípica detalhada, e da equipe multiprofissional no diagnóstico de pacientes com AI.Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES).Amelogenesis imperfecta (AI) is a genetic condition characterized by quantitative and/or qualitative alterations of tooth enamel. AI can manifest as na isolated trait or part of a syndrome. In recent years, variants in 26 genes have been identified in AI cases. The aim of this study was to carry out the clinical characterization and molecular diagnosis of four families with the diagnostic hypothesis of autosomal recessive IA (AIAR) being followed-up in the Oral Care Center for Inherited Diseases, of the University Hospital of Braslia, Brazil. Clinical records were evaluated, and blood from patients and families was collected for DNA extraction by the salting out method and sent for exome sequencing. New variants were validated by Sanger sequencing. Sequences were analyzed on the Varstation® from Varsomics and Franklin, Genoox platforms. Biallelic or homozygous variants in 3 different genes were identified. Homozygous variants in the RELT gene were identified in two sisters with isolated AI (c.120+1G>A,p.?); Two patients with a diagnostic hypothesis of Renal Enamel Syndrome (ERS) had variants in the FAM20A gene, (c.343_362delTCGCTCCTGGCCAGCCAGGA, p. Ser115Glyfs*48 and c.406C>T, p. Arg136*; c.1112 G>A, p. Trp371*); One patient with a diagnosis of dental anomalies and short stature (DASS) had two variants in the LTBP3 gene (c.85_105delCTGCTGCTGCTGCTGCTG, p. Leu29_Leu35del; c.3214C>T, p. Gln1072Ter); and in one patient no pathogenic variants were identified. The results of this study extend the knowledge of the orodental phenotype of patients with isolated and syndromic autosomal recessive amelogenesis imperfecta in Distrito Federal and the spectrum of variants in LTBP3, FAM20A, and RELT genes. Furthermore, they highlight the importance of detailed phenotypic characterization and the multi-professional team in the diagnosis of patients with AI