Trans-Zeatin is the major active phytohormone in immature corn kernels. Herein, a highly sensitive, good selective and simple aptamer-based colorimetric method for the detection of trans-zeatin was constructed. The selected aptamer sequence binds with trans-zeatin and induces a duplex-to-aptamer structure switching. The gold nanoparticles (AuNPs) solution is stable with high-concentration salt, which is protected by red complementary DNA. In the absence of trans-zeatin, the color of AuNPs changed from red to blue because aptamer DNA and complementary DNA form double-stranded DNA. Thus, the ratio of absorbance intensities (A522/A650) of AuNPs is changed with the concentration of trans-zeatin. The color change could be observed by the naked e...
Gold nanoparticles (AuNPs) are often used for biosensing. In particular, aptamer-modified AuNPs are ...
A label-free aptamer-based assay for the highly sensitive and specific detection of Ochratoxin A (OT...
A hypotoxic immunosorbent assay for the detection of zearalenone (ZEN) was developed, by identifying...
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discover...
Zearalenone (ZEN) toxicity is a significant risk for human beings. Thus, it is of high importance to...
Formation of gold nanoparticles in aqueous ethanol in the presence of pyridine-functionalized single...
In this study, a simple, economical and rapid colorimetric assay was developed for the detection of ...
This study addresses the need for rapid pesticide (acetamiprid) detection by reporting a new colorim...
A simple and sensitive colorimetric aptasensor for rapid and facile detection of adenosine triphosph...
A label-free colorimetric method based on exonuclease I (Exo I)-assisted signal amplification with p...
An insufficient sensitivity of aptamer-integrated colorimetric gold nanoparticles (AuNPs) is a commo...
In this work, we reported a rapid and sensitive fluorescence assay in homogenous solution for detect...
This work presents an aptasensor for Ochratoxin A (OTA) using unmodified gold nanoparticles (AuNPs) ...
This study addresses the need for rapid pesticide (acetamiprid) detection by reporting a new colorim...
Here, we designed a simple, rapid, and ultrasensitive colorimetric aptasensor for detecting anatoxin...
Gold nanoparticles (AuNPs) are often used for biosensing. In particular, aptamer-modified AuNPs are ...
A label-free aptamer-based assay for the highly sensitive and specific detection of Ochratoxin A (OT...
A hypotoxic immunosorbent assay for the detection of zearalenone (ZEN) was developed, by identifying...
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discover...
Zearalenone (ZEN) toxicity is a significant risk for human beings. Thus, it is of high importance to...
Formation of gold nanoparticles in aqueous ethanol in the presence of pyridine-functionalized single...
In this study, a simple, economical and rapid colorimetric assay was developed for the detection of ...
This study addresses the need for rapid pesticide (acetamiprid) detection by reporting a new colorim...
A simple and sensitive colorimetric aptasensor for rapid and facile detection of adenosine triphosph...
A label-free colorimetric method based on exonuclease I (Exo I)-assisted signal amplification with p...
An insufficient sensitivity of aptamer-integrated colorimetric gold nanoparticles (AuNPs) is a commo...
In this work, we reported a rapid and sensitive fluorescence assay in homogenous solution for detect...
This work presents an aptasensor for Ochratoxin A (OTA) using unmodified gold nanoparticles (AuNPs) ...
This study addresses the need for rapid pesticide (acetamiprid) detection by reporting a new colorim...
Here, we designed a simple, rapid, and ultrasensitive colorimetric aptasensor for detecting anatoxin...
Gold nanoparticles (AuNPs) are often used for biosensing. In particular, aptamer-modified AuNPs are ...
A label-free aptamer-based assay for the highly sensitive and specific detection of Ochratoxin A (OT...
A hypotoxic immunosorbent assay for the detection of zearalenone (ZEN) was developed, by identifying...