A label-free colorimetric method based on exonuclease I (Exo I)-assisted signal amplification with protamine as a medium was developed for analysis of kanamycin. In this study, a double-stranded DNA (dsDNA) probe was tailored by manipulating an aptamer and its complementary DNA (cDNA) ensuring detection of target with high selectivity and excellent sensitivity. Herein, protamine could not only combine with negatively charged gold nanoparticles but also interaction with polyanion DNA. Upon addition of target kanamycin, the target-aptamer complex was formed and the cDNA was released. Thus, both aptamer and cDNA could be digested by Exo I, and the captured kanamycin was liberated for triggering target recycling and signal amplification. Under ...
Herein, a gold nanoparticle (GNP)-based colorimetric aptasensor has been developed for detecting ade...
Highly sensitive detection of proteins is essential to biomedical research as well as clinical diagn...
The structure-switching aptamers are designed for the simple and rapid detection of kanamycin based ...
A label-free colorimetric method based on exonuclease I (Exo I)-assisted signal amplification with p...
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discover...
A label-free detection method of kanamycin using aptamer-based cantilever array sensor was developed...
A new ultrafast and highly sensitive 'turn-off/turn-on' biosensing approach that combines ...
A label-free, sensitive, simple and general colorimetric method was reported to monitor S1 nuclease ...
DoctorCurrently, the use of antibiotics as prophylactic and therapeutic agents for microbial infecti...
In this work, we developed a simple and general method for highly sensitive detection of proteins an...
Aptamers are DNA or RNA oligonucleotide-based bioreceptors isolated in vitro through the Systematic ...
Smartphone-based fluorescence detection is a promising avenue for biosensing that can aid on-site an...
Aptamers are DNA or RNA oligonucleotide-based bioreceptors isolated in vitro through the Systematic ...
Aptamers are DNA or RNA oligonucleotide-based bioreceptors isolated in vitro through the Systematic ...
Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically a...
Herein, a gold nanoparticle (GNP)-based colorimetric aptasensor has been developed for detecting ade...
Highly sensitive detection of proteins is essential to biomedical research as well as clinical diagn...
The structure-switching aptamers are designed for the simple and rapid detection of kanamycin based ...
A label-free colorimetric method based on exonuclease I (Exo I)-assisted signal amplification with p...
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discover...
A label-free detection method of kanamycin using aptamer-based cantilever array sensor was developed...
A new ultrafast and highly sensitive 'turn-off/turn-on' biosensing approach that combines ...
A label-free, sensitive, simple and general colorimetric method was reported to monitor S1 nuclease ...
DoctorCurrently, the use of antibiotics as prophylactic and therapeutic agents for microbial infecti...
In this work, we developed a simple and general method for highly sensitive detection of proteins an...
Aptamers are DNA or RNA oligonucleotide-based bioreceptors isolated in vitro through the Systematic ...
Smartphone-based fluorescence detection is a promising avenue for biosensing that can aid on-site an...
Aptamers are DNA or RNA oligonucleotide-based bioreceptors isolated in vitro through the Systematic ...
Aptamers are DNA or RNA oligonucleotide-based bioreceptors isolated in vitro through the Systematic ...
Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically a...
Herein, a gold nanoparticle (GNP)-based colorimetric aptasensor has been developed for detecting ade...
Highly sensitive detection of proteins is essential to biomedical research as well as clinical diagn...
The structure-switching aptamers are designed for the simple and rapid detection of kanamycin based ...