The internal initiator x of the rII B cistron of bacteriophage T4 (Sarabhai & Brenner, 1967) can be made to initiate protein synthesis in the absence of a nearby terminating triplet by deleting a particular group of 3n nucleotides to its left. This shows that free ribosomes can directly initiate protein synthesis at an internal initiation sequence, when the initiator is in a structurally favorable configuration
The time of initiation of T4 DNA replication is dependent on the initiation of deoxyribonucleotide s...
Initiation of mRNA translation in bacteria proceeds through several steps. The early events entail t...
Of all tRNAs, initiator tRNA is unique in its ability to start protein synthesis by directly binding...
In protein synthesis, the incorporation of an N-terminal formylmethionine residue is directed by an ...
AbstractPositioning of the translation initiation complex on mRNAs requires interaction between the ...
AbstractThe product from the in vitro transcription of native λDNA by purified E. coli RNA polymeras...
Ribosome recruitment to eukaryotic mRNAs is generally thought to occur by a scanning mechanism, wher...
Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and i...
Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and i...
Formylation of initiator methionyl-tRNA is essential for normal growth of eubacteria. However, under...
We summarize the evidence for multiple pathways to initiate phage T4 DNA replication. In any infecti...
International audienceSelection of correct start codons on mRNAs is a key step required for faithful...
AbstractApUpG, the oligoribonucleotide homologous to the initiation codon, as well as the tetranucle...
Translation of picornavirus RNA is initiated after ribosomal binding to an internal ribosomal entry ...
AbstractThree 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAAC...
The time of initiation of T4 DNA replication is dependent on the initiation of deoxyribonucleotide s...
Initiation of mRNA translation in bacteria proceeds through several steps. The early events entail t...
Of all tRNAs, initiator tRNA is unique in its ability to start protein synthesis by directly binding...
In protein synthesis, the incorporation of an N-terminal formylmethionine residue is directed by an ...
AbstractPositioning of the translation initiation complex on mRNAs requires interaction between the ...
AbstractThe product from the in vitro transcription of native λDNA by purified E. coli RNA polymeras...
Ribosome recruitment to eukaryotic mRNAs is generally thought to occur by a scanning mechanism, wher...
Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and i...
Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and i...
Formylation of initiator methionyl-tRNA is essential for normal growth of eubacteria. However, under...
We summarize the evidence for multiple pathways to initiate phage T4 DNA replication. In any infecti...
International audienceSelection of correct start codons on mRNAs is a key step required for faithful...
AbstractApUpG, the oligoribonucleotide homologous to the initiation codon, as well as the tetranucle...
Translation of picornavirus RNA is initiated after ribosomal binding to an internal ribosomal entry ...
AbstractThree 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAAC...
The time of initiation of T4 DNA replication is dependent on the initiation of deoxyribonucleotide s...
Initiation of mRNA translation in bacteria proceeds through several steps. The early events entail t...
Of all tRNAs, initiator tRNA is unique in its ability to start protein synthesis by directly binding...