The research was conduct to know polymorphism GH gene and allele frequency of FH, and associated of effect of genotype and breed with milk yield, fat and protein content. The research was conduct at BPTU-HPT Baturraden, and Animal Breeding Laboratory UGM. The research was use 62 FH at BPTUHPT Baturraden, consist of 19 FH imported from New Zealand and 43 FH imported from Australia. Blood sampel for DNA molecular analysis was conducted by DNA isolation with SDS-PK modification method, DNA amplification with Polymerase Chain Reaction (PCR) method use the primer pair, GH-Forward: 5�-GCTGCTCC TGAGGGCCCTTC-3� and GH-reverse: 5�- CATGACCCTCAGGTACGTCTC CG-3�, and digesti with Restriction Fragment Length Polymorphism (RLFP) method. Associati...
The present study was conducted to identify polymorphisms of the growth hormone (GH) gene in one of ...
The current study was undertaken to determine the relationship between milk production traits of Eas...
This study was conducted to identify polymorphism of growth hormone gene of Bali cattle. A PCR-RFLP ...
The aim of the research was to determine the associations between polymorphism of the bovine growth ...
ABSTRACT The aim of the research was to determine the associations between polymorphism of the bovi...
<p><span style="font-family: 'Times New Roman', serif;"><span><span><span lang="id-ID">The aim of th...
Growth hormone gene (GH gene) plays an important role in regulating body growth and in developing ma...
Growth hormone gene (GH gene) plays an important role in regulating body growth and in developing ma...
Selection using genetic markers (MAS) is carried out in an effort to accelerate livestock breeding p...
Lactation traits are controlled by many genes, among others, potentially by growth genes. This resea...
Growth hormone gene have a critical role in the regulation of lactation, mammary gland development a...
Kankrej, Gir and Holstein were typed for 3 growth hormone loci to identify the expected RFLP (restri...
The present study was conducted to identify polymorphism of growth hormone (GH) gene in Madura and M...
This study was aimed to identify polymorphism of growth hormone releasing hormone (GHRH) gene in 89 ...
A total of 194 Hereford and 235 composite breed cattle from Wokalup Research Station were used in th...
The present study was conducted to identify polymorphisms of the growth hormone (GH) gene in one of ...
The current study was undertaken to determine the relationship between milk production traits of Eas...
This study was conducted to identify polymorphism of growth hormone gene of Bali cattle. A PCR-RFLP ...
The aim of the research was to determine the associations between polymorphism of the bovine growth ...
ABSTRACT The aim of the research was to determine the associations between polymorphism of the bovi...
<p><span style="font-family: 'Times New Roman', serif;"><span><span><span lang="id-ID">The aim of th...
Growth hormone gene (GH gene) plays an important role in regulating body growth and in developing ma...
Growth hormone gene (GH gene) plays an important role in regulating body growth and in developing ma...
Selection using genetic markers (MAS) is carried out in an effort to accelerate livestock breeding p...
Lactation traits are controlled by many genes, among others, potentially by growth genes. This resea...
Growth hormone gene have a critical role in the regulation of lactation, mammary gland development a...
Kankrej, Gir and Holstein were typed for 3 growth hormone loci to identify the expected RFLP (restri...
The present study was conducted to identify polymorphism of growth hormone (GH) gene in Madura and M...
This study was aimed to identify polymorphism of growth hormone releasing hormone (GHRH) gene in 89 ...
A total of 194 Hereford and 235 composite breed cattle from Wokalup Research Station were used in th...
The present study was conducted to identify polymorphisms of the growth hormone (GH) gene in one of ...
The current study was undertaken to determine the relationship between milk production traits of Eas...
This study was conducted to identify polymorphism of growth hormone gene of Bali cattle. A PCR-RFLP ...