Thermodynamic Analyses of G-Quadruplexes Formed by DNA Molecules Containing Four Repeats of the Human Telomeric Sequence

Oligodeoxyribonucleotides (ODNs) that are rich in guanines can form four stranded DNA structures known as G-quadruplexes (G4s). G4s are stabilized by physiological concentrations of sodium or potassium cations. The human telomere contains tandem repeats of DNA units that are rich in guanines. HTel is an ODN containing four human telomeric repeats with the sequence [d(AGGGTTAGGGTTAGGGTTAGGG)]. It can adopt various intramolecular G4 topologies depending on the type of stabilizing cation and form G4 aggregates at high DNA concentrations. Our studies focused on the biophysical characterization of the G4s formed by HTel. We demonstrated that the aggregation of G4s is independent of the interactions between the non-guanine residues. The aggregation correlates with the thermodynamic stability of the intramolecular G4. We proposed that the partial unfolding of the intramolecular G4 is critical to the aggregation. The factors that contribute to the formation of the G4 aggregate has been under debate. Here we provide important evidence for a novel mechanism of the aggregate formation: the partial unfolding of the intramolecular G4s. The different intramolecular G-quadruplexes conformations are associated with distinct properties. We next conducted an in-depth analysis of the contributions of purines and pyrimidines in the loops of G4s formed by HTel on their structural and thermodynamic properties. We found here that the stacking interactions provided by purines and the rotational freedom of the pyrimidines have compensatory effects on the stability. In addition to providing support to our previous study, the data here has important implications in the design of small molecules that target the human telomere. Finally, we provided volumetric and hydrodynamic properties of the G-quadruplexes formed by HTel. Despite extensive research in the thermodynamic properties of these G4s, little research has been conducted for their volumetric characterization. Here, we investigated the volumetric changes arising from the formation of G4s. We found here that the magnitude of the change in molar volume during the formation of G4 arises from the differential hydraÂŹtion of the DNA molecule and the creation of water-inaccessible cavities. The sequence of the loops can affect the structure of the G4 and consequently their hydration and molar volumes.Ph.D