The present dissertation concerns the purification and properties of an RNA-dependent ribonucleotide-polymerizing enzyme (RNA replicase) produced during infection of E. coli with the RNA bacteriophage f2. Studies on the RNA replicase of the distantly-related bacteriophage Q3 have established the feasibility of using a simplified assay for replicase activity based on the ability of the enzyme to polymerize GTP in the presence of polycytidylic acid template. A similar poly Cdependent poly G polymerase activity is detectable in E. coli infected with bacteriophage f2. The f2 poly G polymerase has been purified by ion exchange chromatography on DEAE cellulose, affinity chromatography on RNA cellulose and density gradient centrifugation. Highly p...
The work covers the RAN-dependent RNA-polymerase of Q beta phage. The aim is to elucidate the causes...
The Pseudomonas phaseolicola bacteriophage ¢6nucleocapsid ncorporated ATP, UTP, CTP and GTP into ssR...
DNA-dependent RNA polymerase from E. coli is now routinely obtained in our laboratory in a highly pu...
This thesis concerns the partial purification and properties of an RNA-dependent RNA polymerase (RNA...
AbstractQβ replicase, an RNA-dependent RNA polymerase of bacteriophage Qβ, uses single-stranded RNA ...
Due to the limited processivity of replicative DNA polymerases (replicases), as well as to their inc...
AbstractThree 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAAC...
The bacterial enzyme DNA-dependent RNA polymerase, which is responsible for synthesis of all types o...
In the introduction an outline of the currently known physical, chemical and enzymic properties of E...
QyS replicases in which the Gly residue of the #-subunit in the motif sequence, YGDD, was replaced w...
The replication of bacteriophage phiX174 was analyzed in various Escherichia coli mutants carrying o...
A new procedure for the purification of B. subtilis RNA polymerase, based on mild lysis of cells, lo...
Gene II-protein of bacteriophage fd was purified from phage-infected Escherichia coli cells more tha...
Bacteriophage fd replicative form DNA with a nick in the viral strand serves as a template for DNa r...
The growth of the RNA-containing bacteriophage f2 has been studied. DNA synthesis appears normal aft...
The work covers the RAN-dependent RNA-polymerase of Q beta phage. The aim is to elucidate the causes...
The Pseudomonas phaseolicola bacteriophage ¢6nucleocapsid ncorporated ATP, UTP, CTP and GTP into ssR...
DNA-dependent RNA polymerase from E. coli is now routinely obtained in our laboratory in a highly pu...
This thesis concerns the partial purification and properties of an RNA-dependent RNA polymerase (RNA...
AbstractQβ replicase, an RNA-dependent RNA polymerase of bacteriophage Qβ, uses single-stranded RNA ...
Due to the limited processivity of replicative DNA polymerases (replicases), as well as to their inc...
AbstractThree 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAAC...
The bacterial enzyme DNA-dependent RNA polymerase, which is responsible for synthesis of all types o...
In the introduction an outline of the currently known physical, chemical and enzymic properties of E...
QyS replicases in which the Gly residue of the #-subunit in the motif sequence, YGDD, was replaced w...
The replication of bacteriophage phiX174 was analyzed in various Escherichia coli mutants carrying o...
A new procedure for the purification of B. subtilis RNA polymerase, based on mild lysis of cells, lo...
Gene II-protein of bacteriophage fd was purified from phage-infected Escherichia coli cells more tha...
Bacteriophage fd replicative form DNA with a nick in the viral strand serves as a template for DNa r...
The growth of the RNA-containing bacteriophage f2 has been studied. DNA synthesis appears normal aft...
The work covers the RAN-dependent RNA-polymerase of Q beta phage. The aim is to elucidate the causes...
The Pseudomonas phaseolicola bacteriophage ¢6nucleocapsid ncorporated ATP, UTP, CTP and GTP into ssR...
DNA-dependent RNA polymerase from E. coli is now routinely obtained in our laboratory in a highly pu...