The stabilization of G-quadruplex DNA structures by small molecules with affinity to oncogene promoters has emerged as a promising anticancer strategy, due to a potential role in gene expression regulation. We explored the ability of BMH-21 (1) and its analogue BA-41 (2) to bind the G-quadruplex structure present in the c-KIT promoter by biophysical methods and molecular modeling. We provide evidence that both compounds interact with the c-KIT 21-mer sequence. The stable monomeric intramolecular parallel G-quadruplex obtained by the mutation of positions 12 and 21 allowed the precise determination of the binding mode by NMR and molecular dynamics studies. Both compounds form a complex characterized by one ligand molecule positioned over the...
Targeting G-quadruplex (G4) DNA structures by small molecules is a potential strategy for directing ...
Specific guanine-rich regions in human genome can form higher-order DNA structures called G-quadrupl...
The outstanding structural polymorphism of DNA allows for the formation of non-canonical secondary s...
The stabilization of G-quadruplex DNA structures by small molecules with affinity to oncogene promot...
The stabilization of G-quadruplex DNA structures by small molecules with affinity to oncogene promot...
Background Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and repre...
Background G-quadruplex DNA structures are hypothesized to be involved in the regulation of gene exp...
The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in ...
G-quadruplex secondary structures are four-stranded globular nucleic acid structures that form in sp...
The 22-mer c-kit promoter sequence folds into a parallel-stranded quadruplex with a unique structure...
Stabilization of G-quadruplex (G4) structures in promoters is a novel promising strategy to regulat...
Suppression of oncogenes transcription represents an ideal tool to integrate the currently available...
The 22-nt c-kit87 promoter sequence is unique within the human genome. Its fold and tertiary structu...
In the last years, it has been shown that the DNA secondary structure known as G-quadruplex is also ...
G-quadruplex structures at telomeric region and in oncogene promotorial sequences represent promisin...
Targeting G-quadruplex (G4) DNA structures by small molecules is a potential strategy for directing ...
Specific guanine-rich regions in human genome can form higher-order DNA structures called G-quadrupl...
The outstanding structural polymorphism of DNA allows for the formation of non-canonical secondary s...
The stabilization of G-quadruplex DNA structures by small molecules with affinity to oncogene promot...
The stabilization of G-quadruplex DNA structures by small molecules with affinity to oncogene promot...
Background Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and repre...
Background G-quadruplex DNA structures are hypothesized to be involved in the regulation of gene exp...
The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in ...
G-quadruplex secondary structures are four-stranded globular nucleic acid structures that form in sp...
The 22-mer c-kit promoter sequence folds into a parallel-stranded quadruplex with a unique structure...
Stabilization of G-quadruplex (G4) structures in promoters is a novel promising strategy to regulat...
Suppression of oncogenes transcription represents an ideal tool to integrate the currently available...
The 22-nt c-kit87 promoter sequence is unique within the human genome. Its fold and tertiary structu...
In the last years, it has been shown that the DNA secondary structure known as G-quadruplex is also ...
G-quadruplex structures at telomeric region and in oncogene promotorial sequences represent promisin...
Targeting G-quadruplex (G4) DNA structures by small molecules is a potential strategy for directing ...
Specific guanine-rich regions in human genome can form higher-order DNA structures called G-quadrupl...
The outstanding structural polymorphism of DNA allows for the formation of non-canonical secondary s...