Fasta file containing the aligned sequences that distinguish mitochondrial inheritance in the progeny of NRRL 29507 and NRRL 21882. Corresponds to the primer pair AF-MIT-3 (F: AGCAGAGGGTTCTGCGTTT, R: GCAGATCAACCTGCTAATAATATTCC)
"Viricel_mtDNA_alignment.fasta" = alignment of all mitochondrial DNA haplotypes (including heteropla...
Each entry is in fasta format and starts with a four character location code, a unique number identi...
This file contains the FASTA alignments for the Sanger loci (traditional mitochondrial and nuclear m...
Fasta file containing the aligned sequences that distinguish mitochondrial inheritance in the progen...
Fasta file containing the aligned sequences that distinguish mitochondrial inheritance in the progen...
Fasta file containing the aligned sequences that distinguish mitochondrial inheritance in the progen...
This file contains .Fasta files for four mitochondrial genome sequences that had Eudyptes warhami an...
This data file contains all the mitochondrial sequences used in the study Beresford et al. in a fast...
Nucleotide alignments in FASTA format for mitochondrial genes sequenced in the FLYTREE PROJECT. Thes...
Sequences and alignments used for whole mitochondrial and control region phylogenies. Sequences file...
*<p>Position of primer sequences corresponds to <i>C. fletcheri</i> mitogenome; F, forward; and R, r...
Unphased DNA sequence alignments for 6 nuclear intron loci and one mitochondrial DNA sequence (ND2) ...
Alignment of mitochondrial large subunit ribosomal DNA used in both clustering analysis by OPTSIL an...
A compressed file containing single-mitochondrial-locus alignments (Cyt-b or COI) for the four Taiwa...
Individual and concatenated fasta files for 3448 Autosomal and 140 Z linked markers identified using...
"Viricel_mtDNA_alignment.fasta" = alignment of all mitochondrial DNA haplotypes (including heteropla...
Each entry is in fasta format and starts with a four character location code, a unique number identi...
This file contains the FASTA alignments for the Sanger loci (traditional mitochondrial and nuclear m...
Fasta file containing the aligned sequences that distinguish mitochondrial inheritance in the progen...
Fasta file containing the aligned sequences that distinguish mitochondrial inheritance in the progen...
Fasta file containing the aligned sequences that distinguish mitochondrial inheritance in the progen...
This file contains .Fasta files for four mitochondrial genome sequences that had Eudyptes warhami an...
This data file contains all the mitochondrial sequences used in the study Beresford et al. in a fast...
Nucleotide alignments in FASTA format for mitochondrial genes sequenced in the FLYTREE PROJECT. Thes...
Sequences and alignments used for whole mitochondrial and control region phylogenies. Sequences file...
*<p>Position of primer sequences corresponds to <i>C. fletcheri</i> mitogenome; F, forward; and R, r...
Unphased DNA sequence alignments for 6 nuclear intron loci and one mitochondrial DNA sequence (ND2) ...
Alignment of mitochondrial large subunit ribosomal DNA used in both clustering analysis by OPTSIL an...
A compressed file containing single-mitochondrial-locus alignments (Cyt-b or COI) for the four Taiwa...
Individual and concatenated fasta files for 3448 Autosomal and 140 Z linked markers identified using...
"Viricel_mtDNA_alignment.fasta" = alignment of all mitochondrial DNA haplotypes (including heteropla...
Each entry is in fasta format and starts with a four character location code, a unique number identi...
This file contains the FASTA alignments for the Sanger loci (traditional mitochondrial and nuclear m...
DOI
Add to ORKG