SummaryBackgroundChromatoid bodies (CBs) are characteristic spermatid organelles, which were suggested to function in RNA storage and small RNA processing but whose functions remain largely unknown. CB components include Mili, Miwi, and Tudor domain proteins such as Tdrd6, whose contribution to CB structure and function is elusive.ResultsWe determined gametogenesis stage- and male-specific expression and localization of Tdrd6, identified a C-terminally truncated form as predominant after meiosis I, and demonstrated direct physical interaction of Tdrd6 with the CB components Mili and Miwi. Development from round into elongated spermatids is abrogated in Tdrd6−/− mice. Their round spermatids bear “ghost” CBs, whose architecture is greatly dis...
Tudor domain containing (Tdrd) proteins that are expressed in germ cells are divided into two groups...
MicroRNAs (miRNAs) are critical regulators of transcriptional and post-transcriptional gene silencin...
Only thirteen microRNAs are conserved between D. melanogaster and the mouse; however, conditional lo...
BACKGROUND: Chromatoid bodies (CBs) are characteristic spermatid organelles, which were suggested to...
SummaryBackgroundChromatoid bodies (CBs) are characteristic spermatid organelles, which were suggest...
Expression of the Tudor domain containing protein 6 (TDRD6), which is restricted to the male germ li...
The chromatoid body (CB) is a unique structure of male germ cells composed of thin filaments that co...
SummaryPiwi proteins are essential for germline development, stem cell self-renewal, epigenetic regu...
ShArm forward 5’- GAATTCTTCAAGGATAAGCTCAACGTGGAGAA ShArm Reverse 5’- CGCCAACCGAGAGCT LongArm forward...
In the male germline in mammals, chromatoid bodies, a specialized assembly of cytoplasmic ribonucleo...
Abstract Mammalian spermatogenesis contains three continuous and organized processes, by which sperm...
The cytoplasmic chromatoid body (CB) organizes mRNA metabolism and small regulatory RNA pathways, in...
International audienceNonsense-mediated RNA decay (NMD) is a highly conserved and selective RNA turn...
SummaryHost-defense mechanisms against transposable elements are critical to protect the genome info...
International audienceThe genome of male germ cells is actively transcribed during spermatogenesis t...
Tudor domain containing (Tdrd) proteins that are expressed in germ cells are divided into two groups...
MicroRNAs (miRNAs) are critical regulators of transcriptional and post-transcriptional gene silencin...
Only thirteen microRNAs are conserved between D. melanogaster and the mouse; however, conditional lo...
BACKGROUND: Chromatoid bodies (CBs) are characteristic spermatid organelles, which were suggested to...
SummaryBackgroundChromatoid bodies (CBs) are characteristic spermatid organelles, which were suggest...
Expression of the Tudor domain containing protein 6 (TDRD6), which is restricted to the male germ li...
The chromatoid body (CB) is a unique structure of male germ cells composed of thin filaments that co...
SummaryPiwi proteins are essential for germline development, stem cell self-renewal, epigenetic regu...
ShArm forward 5’- GAATTCTTCAAGGATAAGCTCAACGTGGAGAA ShArm Reverse 5’- CGCCAACCGAGAGCT LongArm forward...
In the male germline in mammals, chromatoid bodies, a specialized assembly of cytoplasmic ribonucleo...
Abstract Mammalian spermatogenesis contains three continuous and organized processes, by which sperm...
The cytoplasmic chromatoid body (CB) organizes mRNA metabolism and small regulatory RNA pathways, in...
International audienceNonsense-mediated RNA decay (NMD) is a highly conserved and selective RNA turn...
SummaryHost-defense mechanisms against transposable elements are critical to protect the genome info...
International audienceThe genome of male germ cells is actively transcribed during spermatogenesis t...
Tudor domain containing (Tdrd) proteins that are expressed in germ cells are divided into two groups...
MicroRNAs (miRNAs) are critical regulators of transcriptional and post-transcriptional gene silencin...
Only thirteen microRNAs are conserved between D. melanogaster and the mouse; however, conditional lo...