Synthesis and functional activity of translation initiation regions in mRNA 20-base polyribonucleotides from the replicase gene of phage MS2 and fr

AbstractThree 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAACAUGAAGAAUACCCAUG (III), corresponding to the minimal initiation region for the replicase gene of phage MS2 and fr or having some differences were synthesized using enzymatic methods. The template activity of the synthesized polynucleotides in initiation and their capacity to bind phage coat protein were studied under conditions optimal for native mRNA. Polynucleotides I and II exhibit template activity comparable to that of the native phage RNA fragments. Polynucleotide III with the destroyed SD sequence dit not manifest any functional activity either as template or in binding to MS2 phage coat protein.PolyribonucleotideEnzymatic synthesisProtein synthesis initiationTemplate activit