The structure-switching aptamers are designed for the simple and rapid detection of kanamycin based on the signal transduction principle of fluorescence resonance energy transfer (FRET). The structure switch is composed of kanamycin-binding aptamers and the complementary strands, respectively labeled with fluorophore and quencher, denoted as FDNA and QDNA. In the absence of kanamycin, FDNA and QDNA form the double helix structure through the complementary pairing of bases. The fluorophore and the quencher are brought into close proximity, which results in the fluorescence quenching because of the FRET mechanism. In the presence of kanamycin, the FDNA specifically bind to the target due to the high affinity of aptamers, and the QDNA are diss...
The pollution of the environment by various substances is a central issue of our time. Humans introd...
The pollution of the environment by various substances is a central issue of our time. Humans introd...
We describe an innovative selection approach to generate self-reporting aptamers (SRAs) capable of c...
DoctorCurrently, the use of antibiotics as prophylactic and therapeutic agents for microbial infecti...
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discover...
Smartphone-based fluorescence detection is a promising avenue for biosensing that can aid on-site an...
A label-free detection method of kanamycin using aptamer-based cantilever array sensor was developed...
A label-free colorimetric method based on exonuclease I (Exo I)-assisted signal amplification with p...
A label-free colorimetric method based on exonuclease I (Exo I)-assisted signal amplification with p...
Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically a...
A new ultrafast and highly sensitive 'turn-off/turn-on' biosensing approach that combines ...
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. The determination of antibiotics in food i...
In this work, the single-stranded DNA (ssDNA) aptamers specific to florfenicol (FF) and having a hig...
Antibiotics are widely used to kill or inhibit microorganisms, but their abuse results in various ty...
The pollution of the environment by various substances is a central issue of our time. Humans introd...
The pollution of the environment by various substances is a central issue of our time. Humans introd...
The pollution of the environment by various substances is a central issue of our time. Humans introd...
We describe an innovative selection approach to generate self-reporting aptamers (SRAs) capable of c...
DoctorCurrently, the use of antibiotics as prophylactic and therapeutic agents for microbial infecti...
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discover...
Smartphone-based fluorescence detection is a promising avenue for biosensing that can aid on-site an...
A label-free detection method of kanamycin using aptamer-based cantilever array sensor was developed...
A label-free colorimetric method based on exonuclease I (Exo I)-assisted signal amplification with p...
A label-free colorimetric method based on exonuclease I (Exo I)-assisted signal amplification with p...
Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically a...
A new ultrafast and highly sensitive 'turn-off/turn-on' biosensing approach that combines ...
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. The determination of antibiotics in food i...
In this work, the single-stranded DNA (ssDNA) aptamers specific to florfenicol (FF) and having a hig...
Antibiotics are widely used to kill or inhibit microorganisms, but their abuse results in various ty...
The pollution of the environment by various substances is a central issue of our time. Humans introd...
The pollution of the environment by various substances is a central issue of our time. Humans introd...
The pollution of the environment by various substances is a central issue of our time. Humans introd...
We describe an innovative selection approach to generate self-reporting aptamers (SRAs) capable of c...