The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1-P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities. The melting experiments demonstrate that P1-P4 can significantly enhance the stability of the G-quad...
Background G-quadruplex DNA structures are hypothesized to be involved in the regulation of gene exp...
Guanine rich regions of DNA can form higher-order G-quadruplex structures, G-quadrupiex forming sequ...
RATIONALE: The c-myb gene is a potential therapeutic target for human tumors and leukemias. Active i...
The c-kit oncogene plays important roles in cell growth and proliferation which is associated with m...
In this study, electrospray ionization mass spectrometry (ESI-MS) is used to study the formation of ...
In this study, electrospray ionization mass spectrometry (ESI-MS) is used to study the formation of ...
This study has demonstrated the formation of the G-quadruplex structure from the G-rich sequence in ...
International audienceThe quest for small molecules that strongly bind to Gquadruplex-DNA (G4), so-c...
In the last years, it has been shown that the DNA secondary structure known as G-quadruplex is also ...
G-quadruplex structures at telomeric region and in oncogene promotorial sequences represent promisin...
RATIONALE: The c-myb gene is a potential therapeutic target for human tumors and leukemias. Active i...
In the quest for selective G-quadruplex (G4)-targeting chemotypes, natural compounds have been thus ...
In the quest for selective G-quadruplex (G4)-targeting chemotypes, natural compounds have been thus ...
In the quest for selective G-quadruplex (G4)-targeting chemotypes, natural compounds have been thus ...
http://gateway.webofknowledge.com/gateway/Gateway.cgi?GWVersion=2&SrcApp=PARTNER_APP&SrcAuth=LinksAM...
Background G-quadruplex DNA structures are hypothesized to be involved in the regulation of gene exp...
Guanine rich regions of DNA can form higher-order G-quadruplex structures, G-quadrupiex forming sequ...
RATIONALE: The c-myb gene is a potential therapeutic target for human tumors and leukemias. Active i...
The c-kit oncogene plays important roles in cell growth and proliferation which is associated with m...
In this study, electrospray ionization mass spectrometry (ESI-MS) is used to study the formation of ...
In this study, electrospray ionization mass spectrometry (ESI-MS) is used to study the formation of ...
This study has demonstrated the formation of the G-quadruplex structure from the G-rich sequence in ...
International audienceThe quest for small molecules that strongly bind to Gquadruplex-DNA (G4), so-c...
In the last years, it has been shown that the DNA secondary structure known as G-quadruplex is also ...
G-quadruplex structures at telomeric region and in oncogene promotorial sequences represent promisin...
RATIONALE: The c-myb gene is a potential therapeutic target for human tumors and leukemias. Active i...
In the quest for selective G-quadruplex (G4)-targeting chemotypes, natural compounds have been thus ...
In the quest for selective G-quadruplex (G4)-targeting chemotypes, natural compounds have been thus ...
In the quest for selective G-quadruplex (G4)-targeting chemotypes, natural compounds have been thus ...
http://gateway.webofknowledge.com/gateway/Gateway.cgi?GWVersion=2&SrcApp=PARTNER_APP&SrcAuth=LinksAM...
Background G-quadruplex DNA structures are hypothesized to be involved in the regulation of gene exp...
Guanine rich regions of DNA can form higher-order G-quadruplex structures, G-quadrupiex forming sequ...
RATIONALE: The c-myb gene is a potential therapeutic target for human tumors and leukemias. Active i...