<p><b>Copyright information:</b></p><p>Taken from "Optimization and characterization of tRNA-shRNA expression constructs"</p><p></p><p>Nucleic Acids Research 2007;35(8):2620-2628.</p><p>Published online 10 Apr 2007</p><p>PMCID:PMC1885648.</p><p>© 2007 The Author(s)</p> Dual luciferase assays of psiCHECK sense (open bars) and antisense (filled bars) targets. All constructs are normalized to the value of the corresponding empty promoter construct (S4tRNA or the U6) in combination with the relevant target (sense or anti-sense). All hairpins contain the BsrG1 loop except where an asterix (*) denotes the DC loop. (Lane 1) U6 shRNA (DC loop). (Lane 2) S4tRNA-3:70 C:U/DNt-A shRNA (BsrG1 loop). (Lane 3) S4tRNA-W shRNA (BsrG1 loop). (Lane 4) S4t...
The use of RNA interference is becoming routine in scientific discovery and treatment of human dis-e...
<p><b>A</b>. Schematic representation of the shRNA-loop selection experiment. DNA fragments encoding...
Abstract Background RNA interference (RNAi) technology is a powerful methodology recently developed ...
<p><b>Copyright information:</b></p><p>Taken from "Optimization and characterization of tRNA-shRNA e...
<p><b>Copyright information:</b></p><p>Taken from "Optimization and characterization of tRNA-shRNA e...
<p>(A) The sequences of shRNAs. The core 19 nt were obtained from siRNA1 and siRNA4 as mentioned abo...
Progress in constructing biological networks will rely on the development of more advanced component...
Abstract Background RNA interference (RNAi) is a cellular mechanism in which a short/small double st...
<p>(A) An shRNA scaffold targeted to the HBV conserved sequence “GGUAUGUUGCCCGUUUGUCCU” reported pre...
<p><b>a</b>) ShRNAs were PCR-amplified from genomic DNA of selected cell clones as shRNA expression ...
<p><b>Copyright information:</b></p><p>Taken from "Design and cloning strategies for constructing sh...
<div><p>RNA interference (RNAi) is a mechanism for interfering with gene expression through the acti...
There is an acceptance that plasmid-based delivery of interfering RNA always generates the intended ...
<p>(A) The first screening scheme and results of the shRNA library directed against human helicases ...
<p>(A) Overview on mutations introduced into the <i>met</i> leader RNA. SI Table S2 lists all mutate...
The use of RNA interference is becoming routine in scientific discovery and treatment of human dis-e...
<p><b>A</b>. Schematic representation of the shRNA-loop selection experiment. DNA fragments encoding...
Abstract Background RNA interference (RNAi) technology is a powerful methodology recently developed ...
<p><b>Copyright information:</b></p><p>Taken from "Optimization and characterization of tRNA-shRNA e...
<p><b>Copyright information:</b></p><p>Taken from "Optimization and characterization of tRNA-shRNA e...
<p>(A) The sequences of shRNAs. The core 19 nt were obtained from siRNA1 and siRNA4 as mentioned abo...
Progress in constructing biological networks will rely on the development of more advanced component...
Abstract Background RNA interference (RNAi) is a cellular mechanism in which a short/small double st...
<p>(A) An shRNA scaffold targeted to the HBV conserved sequence “GGUAUGUUGCCCGUUUGUCCU” reported pre...
<p><b>a</b>) ShRNAs were PCR-amplified from genomic DNA of selected cell clones as shRNA expression ...
<p><b>Copyright information:</b></p><p>Taken from "Design and cloning strategies for constructing sh...
<div><p>RNA interference (RNAi) is a mechanism for interfering with gene expression through the acti...
There is an acceptance that plasmid-based delivery of interfering RNA always generates the intended ...
<p>(A) The first screening scheme and results of the shRNA library directed against human helicases ...
<p>(A) Overview on mutations introduced into the <i>met</i> leader RNA. SI Table S2 lists all mutate...
The use of RNA interference is becoming routine in scientific discovery and treatment of human dis-e...
<p><b>A</b>. Schematic representation of the shRNA-loop selection experiment. DNA fragments encoding...
Abstract Background RNA interference (RNAi) technology is a powerful methodology recently developed ...