<p>The shRNA cassettes were either introduced stably using retroviral vector (<b>A</b>) or transiently from a plasmid co-transfections with a firefly luciferase reporter construct containing the eGFP target sequence (<b>B</b>). eGFP levels were measured by Flow cytometry. Asterisk denotes the control shRNA containing the loop previously published by Brummelkamp et al. <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0043095#pone.0043095-Brummelkamp1" target="_blank">[11]</a>.</p
<p>(A) Schematic composition of pCAGEGFP-MosIR, pCAGEGFP, and pCAGEGFP-MosMos plasmids. (B) Reporter...
<p>(A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left pane...
<p>(A) Heat map of Spearman correlations among pairs of shRNAs targeting control genes. Correlation ...
<p><b>A</b>. Schematic representation of the shRNA-loop selection experiment. DNA fragments encoding...
<p><b>Copyright information:</b></p><p>Taken from "Reversible gene knockdown in mice using a tight, ...
<p>(A) An shRNA scaffold targeted to the HBV conserved sequence “GGUAUGUUGCCCGUUUGUCCU” reported pre...
<p><b>a</b>) ShRNAs were PCR-amplified from genomic DNA of selected cell clones as shRNA expression ...
<p>(A) The first screening scheme and results of the shRNA library directed against human helicases ...
<p>A. Scheme of tester stock and cross to generate clones of cell expressing double-stranded RNA. Th...
AbstractShort hairpin RNA (shRNA) can be stably expressed in cells to down-modulate gene expression....
<p>(A) & (B) The targeted regions on the RNAs for each of the snoMEN vectors used in this study are ...
<p><b>Copyright information:</b></p><p>Taken from "Reversible gene knockdown in mice using a tight, ...
<p>A) The upper panel (left to right) shows the 293/EcR cells mock transfected with lipofectamine 20...
<p>EGFP-expressing human cell lines (see top row) were infected at an MOI of <0.2 with anti-EGFP shR...
<p>The sgRNA barcode in Perturb-seq is part of the puromycin resistance gene / BFP transcript which ...
<p>(A) Schematic composition of pCAGEGFP-MosIR, pCAGEGFP, and pCAGEGFP-MosMos plasmids. (B) Reporter...
<p>(A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left pane...
<p>(A) Heat map of Spearman correlations among pairs of shRNAs targeting control genes. Correlation ...
<p><b>A</b>. Schematic representation of the shRNA-loop selection experiment. DNA fragments encoding...
<p><b>Copyright information:</b></p><p>Taken from "Reversible gene knockdown in mice using a tight, ...
<p>(A) An shRNA scaffold targeted to the HBV conserved sequence “GGUAUGUUGCCCGUUUGUCCU” reported pre...
<p><b>a</b>) ShRNAs were PCR-amplified from genomic DNA of selected cell clones as shRNA expression ...
<p>(A) The first screening scheme and results of the shRNA library directed against human helicases ...
<p>A. Scheme of tester stock and cross to generate clones of cell expressing double-stranded RNA. Th...
AbstractShort hairpin RNA (shRNA) can be stably expressed in cells to down-modulate gene expression....
<p>(A) & (B) The targeted regions on the RNAs for each of the snoMEN vectors used in this study are ...
<p><b>Copyright information:</b></p><p>Taken from "Reversible gene knockdown in mice using a tight, ...
<p>A) The upper panel (left to right) shows the 293/EcR cells mock transfected with lipofectamine 20...
<p>EGFP-expressing human cell lines (see top row) were infected at an MOI of <0.2 with anti-EGFP shR...
<p>The sgRNA barcode in Perturb-seq is part of the puromycin resistance gene / BFP transcript which ...
<p>(A) Schematic composition of pCAGEGFP-MosIR, pCAGEGFP, and pCAGEGFP-MosMos plasmids. (B) Reporter...
<p>(A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left pane...
<p>(A) Heat map of Spearman correlations among pairs of shRNAs targeting control genes. Correlation ...