<p>* The sequence in bond at the 5′ end of the primer is T7 promoter sequence.</p
Primers used in this study(underlined in the primer sequences were restriction enzyme sites).</p
<p>Nucleotide changes are indicated in small capitals;</p><p>T7 promotor sequence is underlined.</p>...
*<p>Underlined sequences indicate the restriction enzyme sites. All primers are original in this stu...
<p>Restriction sites and T7 promoter sequences are underlined for the primer pairs used for cloning ...
a<p>Nucleotides in bold indicate restriction sites introduced for cloning.</p>b<p>T7 RNA polymerase ...
<p>*The restriction enzyme sequence is underlined.</p><p>**T7 promoter sequence is in bold.</p
<p>*T7 promoter sequences used to generate the JMY dsRNA for knockdown are indicated in bold.</p><p>...
<p>Abbreviations: 7G, 7-glycine linker; F, forward primer; R, reverse primer. Restriction enzyme sit...
<p>MID tag numbers with associated treatment are in italics. Primers had 5’ extensions with unique t...
A<p>F: forward primer; R: reverse primer.</p>B<p>Vimentin-p-F: forward primer for vimentin promoter,...
<p>Note: The underlined sequences represent different restriction enzyme sites.</p><p>Primers used i...
<p>Primers used in this study are indicated (5’-3’).</p><p>Primers used in this study.</p
<p>List of primers used in the experiments. Underlined sequences are the T7 promotor.</p
<p><sup>a</sup>Underlined nucleotides are restriction sites of the enzymes indicated in the brackets...
*<p>T7 bacteriophage promoter sequence (5' TAATACGACTCACTATAGGGAGA 3') was added in 5' of each prime...
Primers used in this study(underlined in the primer sequences were restriction enzyme sites).</p
<p>Nucleotide changes are indicated in small capitals;</p><p>T7 promotor sequence is underlined.</p>...
*<p>Underlined sequences indicate the restriction enzyme sites. All primers are original in this stu...
<p>Restriction sites and T7 promoter sequences are underlined for the primer pairs used for cloning ...
a<p>Nucleotides in bold indicate restriction sites introduced for cloning.</p>b<p>T7 RNA polymerase ...
<p>*The restriction enzyme sequence is underlined.</p><p>**T7 promoter sequence is in bold.</p
<p>*T7 promoter sequences used to generate the JMY dsRNA for knockdown are indicated in bold.</p><p>...
<p>Abbreviations: 7G, 7-glycine linker; F, forward primer; R, reverse primer. Restriction enzyme sit...
<p>MID tag numbers with associated treatment are in italics. Primers had 5’ extensions with unique t...
A<p>F: forward primer; R: reverse primer.</p>B<p>Vimentin-p-F: forward primer for vimentin promoter,...
<p>Note: The underlined sequences represent different restriction enzyme sites.</p><p>Primers used i...
<p>Primers used in this study are indicated (5’-3’).</p><p>Primers used in this study.</p
<p>List of primers used in the experiments. Underlined sequences are the T7 promotor.</p
<p><sup>a</sup>Underlined nucleotides are restriction sites of the enzymes indicated in the brackets...
*<p>T7 bacteriophage promoter sequence (5' TAATACGACTCACTATAGGGAGA 3') was added in 5' of each prime...
Primers used in this study(underlined in the primer sequences were restriction enzyme sites).</p
<p>Nucleotide changes are indicated in small capitals;</p><p>T7 promotor sequence is underlined.</p>...
*<p>Underlined sequences indicate the restriction enzyme sites. All primers are original in this stu...
DOI
Add to ORKG