A label-free detection method of kanamycin using aptamer-based cantilever array sensor was developed. The cantilever array was composed of sensing cantilevers and reference cantilevers. This configuration allowed direct detection of individual cantilever deflections and subsequent determination of differential deflection of sensing/reference cantilever pair. The sensing cantilevers were functionalized with kanamycin aptamer, which was used as receptor molecules while the reference cantilevers were modified with 6-mercapto-1-hexanol (MCH) to eliminate the influence of environmental disturbances. The kanamycin-aptamer interaction induced a change in cantilever surface stress, which caused a differential deflection between the sensing and refe...
Abstract. Cantilever with modified aptamers on the gold surface was employed to detect platelet-deri...
Lipocalin-2 (Lcn2) is a biomarker for many inflammatory-based diseases, including acute kidney injur...
Herein, the molecular recognition sites on the surface of the chip were created by the molecular imp...
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discover...
A label-free colorimetric method based on exonuclease I (Exo I)-assisted signal amplification with p...
A label-free colorimetric method based on exonuclease I (Exo I)-assisted signal amplification with p...
A reversible detection method for vancomycin was developed utilizing the cantilever array sensor fun...
DoctorCurrently, the use of antibiotics as prophylactic and therapeutic agents for microbial infecti...
Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically a...
The structure-switching aptamers are designed for the simple and rapid detection of kanamycin based ...
Cantilever sensors have attracted considerable attention over the last decade because of their poten...
Cantilever sensors have attracted considerable attention over the last decade because of their poten...
A new ultrafast and highly sensitive 'turn-off/turn-on' biosensing approach that combines ...
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. The determination of antibiotics in food i...
A cocaine-specific aptamer was used as a receptor molecule in a microcantilever-based surface stress...
Abstract. Cantilever with modified aptamers on the gold surface was employed to detect platelet-deri...
Lipocalin-2 (Lcn2) is a biomarker for many inflammatory-based diseases, including acute kidney injur...
Herein, the molecular recognition sites on the surface of the chip were created by the molecular imp...
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discover...
A label-free colorimetric method based on exonuclease I (Exo I)-assisted signal amplification with p...
A label-free colorimetric method based on exonuclease I (Exo I)-assisted signal amplification with p...
A reversible detection method for vancomycin was developed utilizing the cantilever array sensor fun...
DoctorCurrently, the use of antibiotics as prophylactic and therapeutic agents for microbial infecti...
Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically a...
The structure-switching aptamers are designed for the simple and rapid detection of kanamycin based ...
Cantilever sensors have attracted considerable attention over the last decade because of their poten...
Cantilever sensors have attracted considerable attention over the last decade because of their poten...
A new ultrafast and highly sensitive 'turn-off/turn-on' biosensing approach that combines ...
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. The determination of antibiotics in food i...
A cocaine-specific aptamer was used as a receptor molecule in a microcantilever-based surface stress...
Abstract. Cantilever with modified aptamers on the gold surface was employed to detect platelet-deri...
Lipocalin-2 (Lcn2) is a biomarker for many inflammatory-based diseases, including acute kidney injur...
Herein, the molecular recognition sites on the surface of the chip were created by the molecular imp...