The polymerase chain reaction (PCR) with oligonucleotide primer sequences from alpha‐amylase genes was used to distinguish between morphologically similar malting and feed barley varieties. The varieties “Chebec” (feed) and “Schooner” (malting) could be separated and the varieties “Skiff” (feed) and “Franklin” (malting) were identified by using two sets of primers. Primer BSW3 (5‐CAGCTTGGCCTCCGGGCAAGTC‐3) and BAS2 (5‐CACCTTGCCGTCGATCTC‐3) gave a 215 bp product that distinguished “Chebec” from “Schooner” and a 1230 bp fragment that distinguished “Skiff” from “Franklin”. Primer BSW5 (5‐GGAGCTGGAATTGATGTTG‐3) with primer BAS2 gave markers at 735 bp and 730 bp respectively to allow unique identification in comparisons of these pairs of varietie...
Polymerase chain reaction (PCR) analysis with specific and arbitrary primers was used to identify ge...
Hordeum spontaneum is the progenitor of cultivated barley (H. vulgare) and is an important source of...
Barley (Hordeum vulgare L.) is widely used for brewing and animal feed. Recently, it has become desi...
The polymerase chain reaction (PCR) can be used to detect DNA polymorphism. Four reference barley ge...
PCR primers based upon sequences from barley alpha-amylase genes were investigated for use in cereal...
Genotype identification in cereals is important as different varieties are suitable for different en...
α-Amylases are the key enzymes involved in the hydrolysis of starch in plants. The polymerase chain ...
Varietal purity is an important commercial driver in the trade of malting barley. Receival standards...
Correct identification of varieties is vital for quality assurance in barley production and use. Mal...
DNA based varietal analysis has now moved from being a research tool to become a routine analytical ...
Abstract- Genetics and breeding studies require effective methods for polymorphism analysis that all...
SIGLEAvailable from British Library Document Supply Centre-DSC:4303.4478(183) / BLDSC - British Libr...
Barley is a genotypically variable species and correct identification of barley varieties is vital f...
A high-throughput single nucleotide polymorphism (SNP) genotyping system was developed and used to s...
In order to study of genetic diversity of barley genotypes, 14 pair’s primers of SSR were used in 20...
Polymerase chain reaction (PCR) analysis with specific and arbitrary primers was used to identify ge...
Hordeum spontaneum is the progenitor of cultivated barley (H. vulgare) and is an important source of...
Barley (Hordeum vulgare L.) is widely used for brewing and animal feed. Recently, it has become desi...
The polymerase chain reaction (PCR) can be used to detect DNA polymorphism. Four reference barley ge...
PCR primers based upon sequences from barley alpha-amylase genes were investigated for use in cereal...
Genotype identification in cereals is important as different varieties are suitable for different en...
α-Amylases are the key enzymes involved in the hydrolysis of starch in plants. The polymerase chain ...
Varietal purity is an important commercial driver in the trade of malting barley. Receival standards...
Correct identification of varieties is vital for quality assurance in barley production and use. Mal...
DNA based varietal analysis has now moved from being a research tool to become a routine analytical ...
Abstract- Genetics and breeding studies require effective methods for polymorphism analysis that all...
SIGLEAvailable from British Library Document Supply Centre-DSC:4303.4478(183) / BLDSC - British Libr...
Barley is a genotypically variable species and correct identification of barley varieties is vital f...
A high-throughput single nucleotide polymorphism (SNP) genotyping system was developed and used to s...
In order to study of genetic diversity of barley genotypes, 14 pair’s primers of SSR were used in 20...
Polymerase chain reaction (PCR) analysis with specific and arbitrary primers was used to identify ge...
Hordeum spontaneum is the progenitor of cultivated barley (H. vulgare) and is an important source of...
Barley (Hordeum vulgare L.) is widely used for brewing and animal feed. Recently, it has become desi...