<p>C1, control 1–RNA isolated from a mouse injected with agrobacteria carrying an empty vector; C2, C3 controls 2 and 3–RNA isolated from HeLa cells transfected with the CMV-based constructs containing the GFP or GFPi gene, respectively. Top panel, GFP-specific RT-PCR products; bottom panel, actin-specific RT-PCR products used as a loading control.</p
In previous studies, genetically altered mice were produced which contained a transgene, providing a...
Lane M: DNA markers; Lane 1: TsCRT+TsSP1.1 immunized murine RNAs amplified by TsCRT+TsSP1.1 primers....
<p>Primers used in the real-time RT-PCR amplification of the mouse procollagen types I and III, MMP-...
<p>HeLa cells were transfected with CMV promoter-based (lanes 1, 2) and CaMV 35S promoter-based cons...
<p>Liver (lanes 1–3, 10, 13–15) after injection with agrobacteria containing the CMV promoter-based ...
<p>GFP accumulation in leaf sectors co-injected with agrobacteria carrying the CaMV 35S promoter-bas...
hCκ forward, 5 ′ ATCTGGAACTGCCTCTGTTGTGTGC 3 ′ served as probe. The primer mCκ forward, 5 ′ GCACCAAC...
<p>Schematic representation of the cytomegalovirus (CMV) promoter- and CaMV 35S promoter-driven gree...
<p>PCR performed with GFP specific forward (5′-AAG TTC ATC TGC ACC ACC G- 3′) and reverse (5′-TCC TT...
<p>Mice were intraperitoneally injected with PBS as control (C) or Tm (2 µg/g body weight) 12 h befo...
<p>A, Bile acid metabolism related genes. B, Cholesterol synthesis related genes. C, Triglyceride me...
<p><b>(A)</b> PCR products from experimental infected BALB/c mice on a different day post infection ...
<p>A. Schematic representation of the location of PCR primers used. Primers RR44, 45, and 46 were us...
<p><b>expression.</b> RT-PCR analysis of <i>RAG-2</i> expression in (A) murine tissues; (C) and (D) ...
<div><p>(A) RT-PCR indicates higher levels of C3H MMTV RNA in spleens derived from infected BALB/c m...
In previous studies, genetically altered mice were produced which contained a transgene, providing a...
Lane M: DNA markers; Lane 1: TsCRT+TsSP1.1 immunized murine RNAs amplified by TsCRT+TsSP1.1 primers....
<p>Primers used in the real-time RT-PCR amplification of the mouse procollagen types I and III, MMP-...
<p>HeLa cells were transfected with CMV promoter-based (lanes 1, 2) and CaMV 35S promoter-based cons...
<p>Liver (lanes 1–3, 10, 13–15) after injection with agrobacteria containing the CMV promoter-based ...
<p>GFP accumulation in leaf sectors co-injected with agrobacteria carrying the CaMV 35S promoter-bas...
hCκ forward, 5 ′ ATCTGGAACTGCCTCTGTTGTGTGC 3 ′ served as probe. The primer mCκ forward, 5 ′ GCACCAAC...
<p>Schematic representation of the cytomegalovirus (CMV) promoter- and CaMV 35S promoter-driven gree...
<p>PCR performed with GFP specific forward (5′-AAG TTC ATC TGC ACC ACC G- 3′) and reverse (5′-TCC TT...
<p>Mice were intraperitoneally injected with PBS as control (C) or Tm (2 µg/g body weight) 12 h befo...
<p>A, Bile acid metabolism related genes. B, Cholesterol synthesis related genes. C, Triglyceride me...
<p><b>(A)</b> PCR products from experimental infected BALB/c mice on a different day post infection ...
<p>A. Schematic representation of the location of PCR primers used. Primers RR44, 45, and 46 were us...
<p><b>expression.</b> RT-PCR analysis of <i>RAG-2</i> expression in (A) murine tissues; (C) and (D) ...
<div><p>(A) RT-PCR indicates higher levels of C3H MMTV RNA in spleens derived from infected BALB/c m...
In previous studies, genetically altered mice were produced which contained a transgene, providing a...
Lane M: DNA markers; Lane 1: TsCRT+TsSP1.1 immunized murine RNAs amplified by TsCRT+TsSP1.1 primers....
<p>Primers used in the real-time RT-PCR amplification of the mouse procollagen types I and III, MMP-...