<p>MEME motifs are represented by position-specific probability matrices that specify the probability of each possible letter appearing at each possible position in an occurrence of the motif. In order to make it easier to see which letters are most likely in each of the columns of the motif, the simplified motif shows the letter probabilities multiplied by 10 rounded to the nearest integer. Zeros are replaced by “:” (a colon) for readability. The information content diagram provides an idea of which positions in the motif are most highly conserved. Each column (position) in a motif can be characterized by the amount of information it contains (measured in bits). Highly conserved positions in the motif have high information; positions where...
Abstract We address the problem of detecting consensus motifs, that occur with subtle variations, a...
Gene regulation, especially cis-regulation of gene expression by the binding of transcription factor...
AbstractWe address the problem of detecting consensus motifs, that occur with subtle variations, acr...
<p>MEME motifs are displayed by stacks of letters at each position. The total height of the stack is...
<p>(A) Five identified statistically significant motifs in amphibian and fish FoxD4L1 sequences. “Si...
<p>Motif 1 has the consensus sequence TATATATATATATATATGTATAT (E-value = 4.6 × 10<sup>−585</sup>) an...
MEME is a tool for discovering motifs in sets of protein or DNA sequences. This paper describes seve...
<p>Occurrences (sites) of the DART motif within the sequences of the 32 dependence receptors that we...
*<p>A consensus sequence of a motif set is a pseudo sequence that has a minimal average distance to ...
In biological sequence research, the positional weight matrix (PWM) is often used for motif signal d...
<p>Multilevel consensus sequences for the MEME defined motifs of members of different calcium sensor...
We address the problem of detecting consensus motifs, that occur with subtle variations, across mult...
<p>Ten dependence receptors plus their orthologues (32 sequences total) were used as a training set ...
Motif id indicates ranks in the MEME output. Motifs are grouped based on overlapping hits in NLRs an...
<p>i.e., an “interesting” subsequence of the DNA—illustrated as a <i>positional weight matrix</i> (P...
Abstract We address the problem of detecting consensus motifs, that occur with subtle variations, a...
Gene regulation, especially cis-regulation of gene expression by the binding of transcription factor...
AbstractWe address the problem of detecting consensus motifs, that occur with subtle variations, acr...
<p>MEME motifs are displayed by stacks of letters at each position. The total height of the stack is...
<p>(A) Five identified statistically significant motifs in amphibian and fish FoxD4L1 sequences. “Si...
<p>Motif 1 has the consensus sequence TATATATATATATATATGTATAT (E-value = 4.6 × 10<sup>−585</sup>) an...
MEME is a tool for discovering motifs in sets of protein or DNA sequences. This paper describes seve...
<p>Occurrences (sites) of the DART motif within the sequences of the 32 dependence receptors that we...
*<p>A consensus sequence of a motif set is a pseudo sequence that has a minimal average distance to ...
In biological sequence research, the positional weight matrix (PWM) is often used for motif signal d...
<p>Multilevel consensus sequences for the MEME defined motifs of members of different calcium sensor...
We address the problem of detecting consensus motifs, that occur with subtle variations, across mult...
<p>Ten dependence receptors plus their orthologues (32 sequences total) were used as a training set ...
Motif id indicates ranks in the MEME output. Motifs are grouped based on overlapping hits in NLRs an...
<p>i.e., an “interesting” subsequence of the DNA—illustrated as a <i>positional weight matrix</i> (P...
Abstract We address the problem of detecting consensus motifs, that occur with subtle variations, a...
Gene regulation, especially cis-regulation of gene expression by the binding of transcription factor...
AbstractWe address the problem of detecting consensus motifs, that occur with subtle variations, acr...