Transcriptomic Study Reveals Widespread Spliced Leader <i>Trans</i>-Splicing, Short 5′-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga <i>Eutreptiella</i> sp.

<div><p><i>Eutreptiella</i> are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a <i>Eutreptiella</i> species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was <i>trans</i>-spliced to the mRNAs of <i>Eutreptiella</i> sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×10⁶ original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL <i>trans</i>-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of <i>Eutreptiella</i> sp. seemed to have short 5′- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C₄ pathway and heterotrophic carbon fixation were found, posing a question whether <i>Eutreptiella</i> sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.</p>