Screening of <i>cis-</i>elements by luciferase assay.

<p>(A) The double-positive <i>cis</i>-elements (<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0068627#pone-0068627-t001" target="_blank">Table 1</a>) were subcloned into a reporter plasmid (pGreenFire1-mCMV), and their transcriptional activity was tested by cotransfection with effecter plasmids (Sox2+Pax6 or Sox2+Brn2) into P19 cells. Fold activation was calculated in comparison to the activity of the negative control reporter plasmid possessing a nonsense sequence as the <i>cis</i>-element. We simultaneously tested positive controls (PC) and negative controls (NC) that possess Sox2-Pax6 or Sox2-Brn2 consensus and mutated elements, respectively. Red and yellow bars represent transcriptional activity of PC and NC, respectively. (B) The transcriptional activity of the <i>cis</i>-element (P16A) in neural stem/progenitor cells <i>in vivo</i> was examined by <i>in utero</i> electroporation of the reporter plasmid. Electroporation was performed on E14 and sampling was done on E15. The positive control reporter plasmid, pGreenFire1-PC (Sox2+Pax6)-mCMV, possesses a Sox2-Pax6 consensus sequence. pGreenFire1-16A-mCMV was generated by inserting the 16A oligpnucleotides:GTGAACCCTTTCAGATTTAGTGACGTAGCTTCACAAAGTGATTAA into pGreenFire1-mCMV. Confocal microscopy (LSM510META, CarlZeiss AG) with 40X water emersion lens was used to visualize the fluorescence. Green fluorescent protein signals were detected in NSPCs, even though the DsRed signals were weaker than the positive control, indicating that 16A possessed strong enhancer activity <i>in vivo</i>.