Increased Nox4 gene expression in aorta of Bmal1-KO mice.

<p>Aortae from WT and Bmal1-KO mice were isolated between ZT2 and ZT4, cryopreserved and total RNA isolated. Relative gene expression was assessed by qRT-PCR for Nox4 (forward primer, TGTTGCATGTTTCAGGTGGT; reverse, AAAACCCTCGAGGCAAAGAT) and Nox1(forward primer, CATGGCCTGGGTGGGATTGT; reverse, TGGGAGCGATAAAAGCGAAGGA) in mouse aorta and normalized to 18S. Bmal1-KO mice exhibited a significant increase in Nox4 gene expression (*P<0.05, n=6).