<p>The cleavage site is indicated with an arrow. Interactions between the hammerhead Spiegelzyme (L-RNA) and the D-RNA substrate of opposite chirality show modified Watson-Crick base pairs with nucleotides in anticlinal conformation (see <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0086673#pone-0086673-g012" target="_blank">Figs. 12</a>–14) and are marked with open bars. The normal Watson-Crick bases in antiperiplanar conformation are indicated with closed bars.</p
The hammerhead ribozyme has long been considered a prototype for understanding RNA catalysis, but di...
The hammerhead RNA is a small catalytic RNA found in a number of RNA virus genomes and virus-like RN...
<p>(A) L-HHRz, 5′-U<sub>1</sub>GGCGCUGAUGAGGCCGAAAGGCCGAAACUUGA<sub>33</sub>-3' (shown in blue) with...
We have captured the structure of a pre-catalytic conformational inter-mediate of the hammerhead rib...
AbstractA new crystal structure of a modified hammerhead ribozyme reveals an intermediate conformati...
The hammerhead ribozyme is a small, intensively studied catalytic RNA, and has been used as a protot...
We have obtained precatalytic (enzyme-substrate complex) and postcatalytic (enzyme-product complex) ...
We report here that a single additional trans-Hoogsteen base-pairing interaction in the minimal hamm...
© 2015 Elsevier Ltd. We report here that a single additional trans-Hoogsteen base-pairing interactio...
ABSTRACT: The hammerhead ribozyme has been intensively studied for approximately 15 years, but its c...
We have captured the structure of a pre-catalytic conformational intermediate of the hammerhead ribo...
Natural or full-length hammerhead ribozymes are up to 1000-fold more active than their minimal count...
<p><b>A.</b> L-HHRz 5′-U<b><sub>1</sub></b>GGCGCUGAUGAGGCCGAAAGGCCGAAACUUGA<b><sub>33</sub></b>-3′ (...
We have constructed a model structure that we believe represents the strongest possible physically a...
We have obtained precatalytic (enzyme-substrate complex) and postcatalytic (enzyme-product complex) ...
The hammerhead ribozyme has long been considered a prototype for understanding RNA catalysis, but di...
The hammerhead RNA is a small catalytic RNA found in a number of RNA virus genomes and virus-like RN...
<p>(A) L-HHRz, 5′-U<sub>1</sub>GGCGCUGAUGAGGCCGAAAGGCCGAAACUUGA<sub>33</sub>-3' (shown in blue) with...
We have captured the structure of a pre-catalytic conformational inter-mediate of the hammerhead rib...
AbstractA new crystal structure of a modified hammerhead ribozyme reveals an intermediate conformati...
The hammerhead ribozyme is a small, intensively studied catalytic RNA, and has been used as a protot...
We have obtained precatalytic (enzyme-substrate complex) and postcatalytic (enzyme-product complex) ...
We report here that a single additional trans-Hoogsteen base-pairing interaction in the minimal hamm...
© 2015 Elsevier Ltd. We report here that a single additional trans-Hoogsteen base-pairing interactio...
ABSTRACT: The hammerhead ribozyme has been intensively studied for approximately 15 years, but its c...
We have captured the structure of a pre-catalytic conformational intermediate of the hammerhead ribo...
Natural or full-length hammerhead ribozymes are up to 1000-fold more active than their minimal count...
<p><b>A.</b> L-HHRz 5′-U<b><sub>1</sub></b>GGCGCUGAUGAGGCCGAAAGGCCGAAACUUGA<b><sub>33</sub></b>-3′ (...
We have constructed a model structure that we believe represents the strongest possible physically a...
We have obtained precatalytic (enzyme-substrate complex) and postcatalytic (enzyme-product complex) ...
The hammerhead ribozyme has long been considered a prototype for understanding RNA catalysis, but di...
The hammerhead RNA is a small catalytic RNA found in a number of RNA virus genomes and virus-like RN...
<p>(A) L-HHRz, 5′-U<sub>1</sub>GGCGCUGAUGAGGCCGAAAGGCCGAAACUUGA<sub>33</sub>-3' (shown in blue) with...