Effect of Ca₂EDTA on hypobaric hypoxia induced alteration in expression of HIF-1α.

<p>Photomicrographs show the expression of HIF-1α counter stained with Hoechst 33342 (A) in CA3 hippocampal region of normoxia (a), normoxia treated with Ca₂EDTA (b), hypoxia (c) and hypoxia treated with Ca₂EDTA (d) (Magnification ×400). Graph represents relative mean fluorescence intensity of HIF-1α expression in hippocampal sections of CA3 region (B) and <i>HIF-1α</i> mRNA (216 bp) expression and relative OD (C) in hippocampus. *** indicate p<0.001;* compared hypoxia vs normoxia treated with Ca₂EDTA. ## indicate p<0.01, # compared hypoxia hreated Ca₂EDTA vs hypoxia. NED-Normoxia Treated with Ca₂EDTA, IH-Hypoxia and HED-Hypoxia Treated with Ca₂EDTA. Lane 1,2-Normoxia, Lane 3,4-Normoxia treated with Ca₂EDTA, Lane 5,6- Hypoxia and Lane 7,8- Hypoxia treated with Ca₂EDTA. M indicate Marker lane. <i>HIF-1α</i> – Forward primer: 5′ - AGAAACCTACCATCACTGCCACT- 3′, Reverse primer: 5′ – TGTTCTATGACTCTCTTTCCTGC - 3′ (216 bp). Scale bar = 5 µm.