Cytogenetic results and bioinformatic analyses of the RNA-Seq data of the retroperitoneal leiomyoma.

<p>A) Partial karyotype showing the der(10)t(10;17)(q22;q21) and der(17)t(10;17)(q22;q21) together with the corresponding normal chromosome homologs; breakpoint positions are indicated by arrows. B) The 101 bp sequence obtained from the raw data of RNA-Seq using the command “grep”. The search term “TACCCCATGAGAAAGACCAG” is underlined. C) The results of BLAT search genome using the 101 bp sequence (see B) on the human genome browser-hg19 assembly (<a href="http://genome-euro.ucsc.edu/cgi-bin/hgGateway" target="_blank">http://genome-euro.ucsc.edu/cgi-bin/hgGateway</a>). D) Ideogram of chromosome 10 showing that nucleotides 1–43 of the 101 bp sequence (see B) are mapped on band q22.2 (red vertical line). E) The result of BLAT search (your sequence from BLAT search) showed that nucleotides 1–43 are part of the <i>KAT6B</i> coding region. F) Ideogram of chromosome 17 showing that nucleotides 41–101 of the sequence from B are mapped on band q21.3 (red vertical line). G) The result of BLAT search (your sequence from BLAT search) shows that the nucleotides are part of the <i>KANSL1</i> coding region.