Zurich Open Repository andArchiveUniversity of ZurichUniversity LibraryStrickhofstrasse 39CH-8057 Zurichwww.zora.uzh.chYear: 2022The Role of CD200–CD200 Receptor in Human Blood and LymphaticEndothelial Cells in the Regulation of Skin Tissue InflammationRütsche, Dominic ; Michalak-Mićka, Katarzyna ; Zielinska, Dominika ; Moll, Hannah ; Moehrlen, Ueli ;Biedermann, Thomas ; Klar, Agnes SAbstract: CD200 is a cell membrane glycoprotein that interacts with its structurally related recep-tor (CD200R) expressed on immune cells. We characterized CD200–CD200R interactions in humanadult/juvenile (j/a) and fetal (f) skin and in in vivo prevascularized skin substitutes (vascDESS) pre-pared by co-culturing human dermal microvascular endothelial cells (HDMEC), containing both blood(BEC) and lymphatic (LEC) EC. We detected the highest expression of CD200 on lymphatic capillariesin j/a and f skin as well as in vascDESS in vivo, whereas it was only weakly expressed on blood capillaries.Notably, the highest CD200 levels were detected on LEC with enhanced Podoplanin expression, whilereduced expression was observed on Podoplanin-low LEC. Further, qRT-PCR analysis revealed upregu-lated expression of some chemokines, including CC-chemokine ligand 21 (CCL21) in j/aCD200+ LEC,as compared to j/aCD200− LEC. The expression of CD200R was mainly detected on myeloid cells suchas granulocytes, monocytes/macrophages, T cells in human peripheral blood, and human and rat skin.Functional immunoassays demonstrated specific binding of skin-derived CD200+ HDMEC to myeloidCD200R+ cells in vitro. Importantly, we confirmed enhanced CD200–CD200R interaction in vascDESSin vivo. We concluded that the CD200–CD200R axis plays a crucial role in regulating tissue inflammationduring skin wound healing.DOI: https://doi.org/10.3390/cells11061055Posted at the Zurich Open Repository and Archive, University of ZurichZORA URL: https://doi.org/10.5167/uzh-218415Journal ArticlePublished Version The following work is licensed under a Creative Commons: Attribution 4.0 International (CC BY 4.0)License.Originally published at:Rütsche, Dominic; Michalak-Mićka, Katarzyna; Zielinska, Dominika; Moll, Hannah; Moehrlen, Ueli;Biedermann, Thomas; Klar, Agnes S (2022). The Role of CD200–CD200 Receptor in Human Blood andLymphatic Endothelial Cells in the Regulation of Skin Tissue Inflammation. Cells, 11:1055.DOI: https://doi.org/10.3390/cells11061055Citation: Rütsche, D.; Michalak-Micka, K.; Zielinska, D.; Moll, H.;Moehrlen, U.; Biedermann, T.; Klar,A.S. The Role of CD200–CD200Receptor in Human Blood andLymphatic Endothelial Cells in theRegulation of Skin TissueInflammation. Cells 2022, 11, 1055.https://doi.org/10.3390/cells11061055Academic Editor: Michèle T. MartinReceived: 1 January 2022Accepted: 16 March 2022Published: 21 March 2022Publisher’s Note: MDPI stays neutralwith regard to jurisdictional claims inpublished maps and institutional affil-iations.Copyright: © 2022 by the authors.Licensee MDPI, Basel, Switzerland.This article is an open access articledistributed under the terms andconditions of the Creative CommonsAttribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).cellsArticleThe Role of CD200–CD200 Receptor in Human Blood andLymphatic Endothelial Cells in the Regulation of SkinTissue InflammationDominic Rütsche 1,2,3,† , Katarzyna Michalak-Micka 1,2,3,†, Dominika Zielinska 1,2,3, Hannah Moll 1,2,3,Ueli Moehrlen 1,2,3,4, Thomas Biedermann 1,2,3 and Agnes S. Klar 1,2,3,*1 Tissue Biology Research Unit, Department of Surgery, University Children’s Hospital Zurich,8032 Zurich, Switzerland; dominic.ruetsche@kispi.uzh.ch (D.R.); katarzyna.micka@kispi.uzh.ch (K.M.-M.);dominika.zielinska@kispi.uzh.ch (D.Z.); hannah.moll@gmx.ch (H.M.); ueli.moehrlen@kispi.uzh.ch (U.M.);thomas.biedermann@kispi.uzh.ch (T.B.)2 Children’s Research Center, University Children’s Hospital Zurich, 8032 Zurich, Switzerland3 Faculty of Medicine, University of Zurich, 8032 Zurich, Switzerland4 Department of Pediatric Surgery, University Children’s Hospital Zurich, 8032 Zurich, Switzerland* Correspondence: agnes.klar@kispi.uzh.ch; Tel.: +41-446348819† These authors contributed equally to this work.Abstract: CD200 is a cell membrane glycoprotein that interacts with its structurally related receptor(CD200R) expressed on immune cells. We characterized CD200–CD200R interactions in humanadult/juvenile (j/a) and fetal (f) skin and in in vivo prevascularized skin substitutes (vascDESS)prepared by co-culturing human dermal microvascular endothelial cells (HDMEC), containing bothblood (BEC) and lymphatic (LEC) EC. We detected the highest expression of CD200 on lymphaticcapillaries in j/a and f skin as well as in vascDESS in vivo, whereas it was only weakly expressed onblood capillaries. Notably, the highest CD200 levels were detected on LEC with enhanced Podoplaninexpression, while reduced expression was observed on Podoplanin-low LEC. Further, qRT-PCRanalysis revealed upregulated expression of some chemokines, including CC-chemokine ligand21 (CCL21) in j/aCD200+ LEC, as compared to j/aCD200− LEC. The expression of CD200R wasmainly detected on myeloid cells such as granulocytes, monocytes/macrophages, T cells in humanperipheral blood, and human and rat skin. Functional immunoassays demonstrated specific bindingof skin-derived CD200+ HDMEC to myeloid CD200R+ cells in vitro. Importantly, we confirmedenhanced CD200–CD200R interaction in vascDESS in vivo. We concluded that the CD200–CD200Raxis plays a crucial role in regulating tissue inflammation during skin wound healing.Keywords: CD200 (OX2); CD200 receptor; regenerative medicine; blood capillaries; lymphatic capil-laries; angiogenesis–immune cells/myeloid cells; microvascular endothelial cells; skin bioengineering1. IntroductionLoss of skin due to congenital diseases or traumatic tissue defects (e.g., burns) result inconcomitant loss of its barrier function. Although some superficial skin defects with intactdermal elements may heal without autografting, deep partial-thickness and full-thicknessburn wounds require autografting of healthy skin from an uninjured site (the donor site)and its placement on the primary wound site [1]. Although such split-thickness autograftsare the standard of care, for example, for large burns, the autograft donor site often resultsin a secondary wound. Moreover, these sites, but especially the primary wounds, exhibitsignificant scarring, contracture, and loss of function [1].Bioengineered human dermo-epidermal full-thickness skin substitute (DESS) [2–8] of-fer an alternative to those autografts, showing improved graft take and reduced contraction,shrinkage, and scarring [9,10]. Recently, our group developed a complex human prevascu-larized DESS (vascDESS) containing a mature blood and lymphatic vascular network thatCells 2022, 11, 1055. https://doi.org/10.3390/cells11061055 https://www.mdpi.com/journal/cellsCells 2022, 11, 1055 2 of 27becomes rapidly perfused after transplantation by inosculation [11]. Organotypic capillarynetworks were self-assembled in vitro by co-culture of human primary dermal microvascu-lar endothelial cells (HDMEC) and human dermal fibroblasts (HDF) in three-dimensional(3D) collagen type I hydrogels [11].In this study, we were particularly interested in CD200 (OX-2) expression in HDMEClining blood and lymphatic capillaries of vascDESS in vitro and in vivo. CD200 has a widebut specific tissue distribution that includes certain vascular endothelia, kidney glomeruli,placental cells, and neurons [11,12]. Its cognate receptor CD200R is primarily expressed onmyeloid cells and certain subsets of B and T cells [13,14]. Interestingly, CD200 glycoproteinis involved in the regulation of macrophage function and the control of alloimmune andautoimmune responses through its receptor, CD200R.The presence of CD200 molecules on the cell surface is essential to interact withCD200R to keep tissue homeostasis and avoid exaggerated immune responses leadingto tissue damage [15,16]. Accordingly, CD200-knockout animals demonstrated chronicinflammation of the central nervous system (CNS), the onset of experimental autoimmuneencephalomyelitis, and showed higher susceptibility to autoimmune reactions due toimpaired CD200–CD200R interaction in response to injury [15,16]. Outside the CNS, theexpression of CD200 by hair follicle epithelium in the skin was found to attenuate immuneresponses in an alopecia model [17].Furthermore, the immunosuppressive capacity of CD200 was demonstrated to reg-ulate also tissue homeostasis in the central and peripheral nervous system [18], vascularendothelia [19], skin [20], and lymphoid cells [21]. Previous studies demonstrated, that dur-ing homeostasis, CD200 maintains an adequate level of activated CD200R+ macrophagesto preserve tissue integrity, whereas reduced expression of CD200 attenuates macrophage-mediated tissue damage [20,22]. Hence, mice lacking CD200 showed a phenotype withincreased numbers of activated CD11b+ macrophages and granulocytes [15,22]. CD200–CD200R signaling inhibits cytokine release, mast cell degranulation, and cellular infiltrationtogether with increased attraction or expansion of Treg subsets and diminution of T celleffector responses [23]. Further, there are several lines of evidence suggesting that theimmunosuppressive capacity of CD200 may also stimulate cancer growth by decreasingthe immune response against cancer cells. For example, CD200 was found upregulatedin vascular endothelium surrounding cutaneous squamous cell carcinoma (SCC) [24], inmetastatic SCC [25], in chronic lymphocytic leukemia [26], and acute myeloid leukemia [27],melanoma [28], and multiple myeloma [29].The CD200–CD200R link was described to play a crucial role in regulating the immuneresponse, also during skin wound healing [20]. As such, the CD200–CD200R link is crucialfor immunomodulation and attenuated immune cell response and, thus, can reduce scarformation in cutaneous wounds [19]. We aimed here to compare BEC/LEC from adultversus fetal skin, as fetal wounds of the first-trimester pregnancy can heal spontaneouslywithout any scarring [30,31]. This is due to a very low immune cell response and reducedinflammation in those wounds [32]. We believe that the CD200–CD200R link, in particularin EC, might play an important role in this regulation.Here, we report for the first time the characterization of human CD200 and its cognatereceptor in human juvenile/adult and fetal skin as well as in bioengineered vascDESS. Wedemonstrate that CD200 is expressed on both blood and lymphatic capillaries both in vitroand in vivo, whereas CD200R is detected on peripheral blood-derived monocytes, granulo-cytes, NK, and T-cells. Moreover, we provide functional assays confirming the importanceof CD200–CD200R interaction for immune responses and for skin wound healing.2. Materials and Methods2.1. Cell Isolation and CultureAll experiments were performed according to the Declaration of Helsinki Principlesand after permission from the Ethics Commission of the Canton Zurich. Human skin-derived dermal microvascular endothelial cells (HDMECs), dermal fibroblasts (HDF), andCells 2022, 11, 1055 3 of 27keratinocytes (KC) were isolated and expanded from fetal skin obtained from Spina Bifidaoperations between 24 and 26 weeks of gestational age (University Children’s HospitalZurich, ethics approval: BASEC No. PB_2020-00066), juvenile/adult skin including foreskin,scalp, skin from the hands, abdomen, legs, and arms from children ≤18 years (UniversityChildren’s Hospital Zurich, BASEC No. 2018-00269); adult skin donors (18–65 years old)from various body areas such as breast and abdomen (Kantonsspital Aarau, ethics approval:BASEC No. 2018-00269) as previously described [11,33]. HUVEC were purchased fromScienceCell (ordering no 8000, Switzerland) and cultured as previously described [11].Blood-derived immune cells were collected from buffy coats. Briefly, peripheral bloodmononuclear cells (PBMCs) were isolated by Ficoll gradient from blood donated by healthyvolunteers. Informed written consent was obtained from all blood donors at the ZurichBlood Donation Center (Zurich Blood Transfusion Service of the Swiss Red Cross, Schlieren,Switzerland; www.zhbsd.ch (accessed on 18 March 2022)) according to the guidelines ofthe local ethics committee.2.2. Flow Cytometry and ImmunohistochemistryFlow cytometry: The phenotype of freshly isolated and cultured HDMEC and/or BECand LECs and immune cells was determined by flow cytometry analysis. Cells (5 × 105)were incubated for 30 min at 4 ◦C in with primary antibodies and live/dead Zombie Aqua(Table 1). Parallel stainings using isotype-matched control antibodies were conducted(Table 1):Table 1. Antibody conjugates used in flow cytometry.Antibody Conjugate Clone Product Number Manufacturer DilutionCD15-PE (SSEA-1) W6D3 323006 BioLegend, Switzerland 1:20PE Mouse IgG1, κ Isotype Ctrl MOPC-21 400114 BioLegend, Switzerland 1:20CD56-APC MEM-188 304610 BioLegend, Switzerland 1:20APC Mouse IgG2a, κ Isotype Ctrl MOPC-173 400220 BioLegend, Switzerland 1:20CD3-FITC UCHT1 300452 BioLegend, Switzerland 1:50FITC Mouse IgG1, κ Isotype Ctrl MOPC-21 400108 BioLegend, Switzerland 1:50CD14-FITC M5E2 555397 BD Biosciences, Switzerland 1:50CD200-AF647 OX-104 329214 BioLegend, Switzerland 1:50Alexa Fluor 647 Mouse IgG1, κ Isotype Ctrl MOPC-21 400130 BioLegend, Switzerland 1:50CD200R-APC OX-108 329308 BioLegend, Switzerland 1:20APC Mouse IgG1, κ Isotype Ctrl MOPC-21 400122 BioLegend, Switzerland 1:20CD31-PE WM59 555446 BD Biosciences, Switzerland 1:20PE Mouse IgG1, κ Isotype Control MOPC-21 555749 BD Biosciences, Switzerland 1:50Podoplanin-AF488 NC-08 337006 BioLegend, Switzerland 1:50Alexa Fluor® 488 Rat IgG2a, κ Isotype Ctrl RTK2758 400525 BioLegend, Switzerland 1:50ZombieAqua Fixable Viability Kit - 423102 BioLegend, Switzerland 1:500Following the incubation with antibodies, cells were washed twice with FACS buffer(0.5% human serum albumin, 0.5 mM EDTA in PBS) and then analyzed by flow cytometryon a FACS ARIA III 4L (BD Biosciences, Allschwil, Switzerland).Immunohistochemistry: Immunofluorescence staining on cryosections was performedas described before [6,8] (Table 2).Cells 2022, 11, 1055 4 of 27Table 2. Antibodies used in immunohistochemical stainings.Antibody Clone Product Number Manufacturer DilutionAnti-humanCD31 JC70A M082301-2 Dako, USA 1:50CD31-PE WM59 555446 BD Biosciences, Switzerland 1:50CD90 AS02 CP28-200UG Merck Millipore, Germany 1:100CD200 OX-104 329202 BioLegend, Switzerland 1:50CD200-AF647 OX-104 329214 BioLegend, Switzerland 1:50CD200R OX-108 329302 BioLegend, Switzerland 1:50CD200R-APC OX-108 329308 BioLegend, Switzerland 1:20Collagen IV COL-94 ab6311 Abcam, UK 1:200Ki67 B56 550609 BD Biosciences, Switzerland 1:100LYVE1 polyclonal Ab10278 Abcam, UK 1:100Podoplanin 18H5 sc-59347 Santa Cruz, USA 1:100Podoplanin-AF488 NC-08 337006 BioLegend, Switzerland 1:50Podoplanin-AF647 NC-08 337008 BioLegend, Switzerland 1:20PROX1 polyclonal 102-PA32S ReliaTech, Germany 1:100Anti-ratAnti-rat Granulocytes HIS48 sc-19613 Santa Cruz, USA 1:100Anti-rat Myeloid Lineage Antibody-FITC OX-82 205103 BioLegend, Switzerland 1:50CD68 PG-M1 Ab783 Abcam, UK 1:100CD200R-FITC OX-102 204905 BioLegend, Switzerland 1:20Secondary antibodiesDonkey anti-mouse IgG H&L AF488 ab150105 Abcam, UK 1:400Donkey anti-rabbit IgG H&L AF488 ab150073 Abcam, UK 1:200Donkey anti-mouse IgG H&L AF568 ab175472 Abcam, UK 1:400Anti-rabbit IgG H&L AF568 ab175470 Abcam, UK 1:200Anti-mouse IgG H&L AF647 ab150107 Abcam, UK 1:200For double immunofluorescence, some of the primary antibodies were pre-labeledwith Alexa 488, 647, or 555-conjugated polyclonal goat F(ab′)2 fragments, according to themanufacturer’s instructions (Zenon Mouse IgG Labeling Kit, Molecular Probes, Invitrogen).2.3. Proliferation AssayThe proliferation ability of cultured HDMEC was determined using colorimetric CellCounting Kit-8 kit (CKK-8) according to manufacturer’s instructions (Cell Counting Kit-8,Sigma, Buchs, Switzerland). Briefly, BECs, CD200+ LECs, or CD200− LECs (passage 1–2),isolated and sorted from fetal and juvenile/adult skin samples, were seeded in 24-wellplates at the density of 20,000 cells/well. Triplicates were prepared for each cell type.Subsequently, cells were treated with diluted CKK-8 solution for 1 h at 37 ◦C, and then, theabsorbance was measured at a wavelength of 450 nm with a microplate reader (BioTek,Winooski, VT, USA). The procedure was repeated every second day for 11 days. OD valuesreflect the number of viable cells. Mean absorbance values and SDs were calculated at eachtime point.Cells 2022, 11, 1055 5 of 272.4. Cell Viability AssayFor the viability assay on j/aHDMECs (mixtures of BEC:LEC), cells were concomi-tantly stained with FdA (80 µg/mL; Sigma F7378, Buchs, Switzerland), PI (200 µg/mL;Sigma P4864, Buchs, Switzerland), and Hoechst 33342 (1 µg/mL; Sigma B2261, Buchs,Switzerland) was conducted. For Ki67/CD31 stainings, non-treated cells were fixed withacetone/methanol (1:1) at −20 ◦C for 5 min and subsequently stained as described above(section “Immunohistochemistry”). Both the viability assay as well as Ki67/CD31 stainingwere performed every second day for 11 days.2.5. ImmunoassaySorted CD200+/− BEC and LEC were seeded onto 24 well plates and cultured untilconfluency. Once confluency was achieved, peripheral blood mononuclear cells (PBMCs)were isolated from fresh whole human blood. For this, buffy coats (Zurich Blood Transfu-sion Service of the Swiss Red Cross, Schlieren, Switzerland) were diluted with PBS (1:1)and gently layered over an equal volume of Ficoll-Paque PLUS (GE Healthcare, Opfikon,Switzerland) and then centrifuged for 30 min at 400 g without brake. After centrifugation,the PBMC fraction was removed, transferred into a new Falcon tube, and subsequentlywashed twice with PBS. Following the isolation, PBMCs were immediately sorted (FACSARIA III 4L (BD Biosciences, Wokingham, UK) into the different lymphocyte subtypes thathave been shown to express the CD200 Receptor (CD200R). Next, adherent endothelial cellswere stained with CellTracker Deep Red Dye (Invitrogen, Zug, Switzerland), and sortedlymphocytes were stained with CellTracker Red CMTPX Dye (Invitrogen, Switzerland)according to the manufacturer’s instructions. Stained cells were then co-cultured in anincubator at 37 ◦C for 30 min. The lymphocytes were then added on top of the endothelialcells and left for another 30 min at 37 ◦C. In the last step, all cells were stained with Hoechst33342 (Sigma-Aldrich, Buchs, Switzerland), fixed in PFA (4%), and analyzed on the confocalmicroscope (Leica SP8 inverse CLSM). The quantification was performed using Fiji (ver.1.53i, NIH, Bethesda, MA, USA) by counting the number of immune cells to endothelialcells (Immune cells/EC ratio).2.6. Clonogenic AssayTo assess the potential of CD200− and CD200+ LEC to form colonies in vitro, weperformed a clonogenic assay. Sorted CD200− and CD200+ LEC (200, 600, and 1000 re-spectively) were seeded into gelatin-coated 6-wells in EGM-2MV medium (Lonza, Basel,Switzerland). After seeding, the cells were left to proliferate for 14 days with mediumchange every 2 days. On day 14, the medium was aspirated and the cells were washed oncewith DPBS (Invitrogen, Zug, Switzerland). Next, 3 mL of a mixture of 6% glutaraldehydeand 0.5% crystal violet solution (each diluted in water, all Sigma-Aldrich, Buchs, Switzer-land) was added to each well for 30 min and removed carefully. Cells were washed withwater and left to dry. Cell colonies were counted by eye.2.7. qRT-PCRTotal RNA was isolated from cultured cells either grown on culture dishes or directlyfollowing FACS sorting according to the manufacturer’s protocol (RNeasy, Qiagen, Hom-brechtikon, Switzerland), including a DNAse treatment to remove genomic DNA. Threebiological replicates were collected per condition. RNA purity was assessed using an Epochspectrophotometer (Take3 micro-volume plate, BioTek, Lucerne, Switzerland). Only pureRNA with absorption ratios A260/A280 ~2.0–2.1 and A260/A230 ~2.1–2.3 were used forqRT-PCR. RNA was stored at −80 ◦C until further use. qRT-PCR was performed accord-ing to published protocols [34–37]. First, single-stranded RNA was converted to cDNAusing the GoScript Reverse Transcriptase kit (Promega, Madison, WI, USA), following themanufacturer’s instructions. qRT-PCR was carried out in technical triplicates (n = 3) usingSYBR green chemistry (PowerTrack SYBR Green Master Mix, Invitrogen, Zug, Switzerland).Each 10 µL reaction contained 5 ng of cDNA, and amplification steps were carried outCells 2022, 11, 1055 6 of 27on a QuantStudio 7 Pro Real-Time PCR System (Applied Biosystems, Invitrogen, Zug,Switzerland). All data were normalized to GAPDH and quantification was performedusing the 2−∆∆CT method with efficiency correction (Pfaffl method) [23]. All primers weredesigned by ourselves except for TGF-B1 [38] and CD200 [39] (Table 3).Table 3. Primers used in qRT-PCR analysis.Gene Name Forward ReverseCCL21 CCATCCCAGCTATCCTGTTCTT TTCTGTGGGGATGGTGTCTTGCCL27 CAGACCCTACAGCAGCATTCC CACGAAAGCCTGGAGGTGACCD62P CCCGAGTCCTTAAGGTTTCCAT GGAAACAGGGTTGGTCCAGACD54 CAGTGACCATCTACAGCTTTCC CATTCAGCGTCACCTTGGCTVCAM1 GGAAATGACCTTCATCCCTACCA ATCTCTGGGGGCAACATTGAICAM2 GATTTTGGCAGTGTCGAGGTCT GGAGCCTGAGGTGTTTCACTTTF11R CGAGGCCACTTTGACAGAACA CCTTCACTTCGGGCACTAGGTGFBeta1 TGAACCGGCCTTTCCTGCTTCTCATG GCGGAAGTCAATGTACAGCTGCCGCCD200/OX2 CCTAAGAATCAGGTGGGGAAGGA GACGAGAAGAATTACCAGGGAAACACD157/BST1 CGCACACTTGCGGGACATC AGTTCTTGTTCCGCTGCTCGPodoplanin AAGAGCTGAAGGGTTACGCC CACGGGTCATCTTCTCCCACProx1 AAGCAAATGACTTTGAGGTTCC CAGCTTGCAGATGACCTTGTGAPDH AGTCAGCCGCATCTTCTTTT CCAATACGACCAAATCCGTTG2.8. Preparation of vascDESS and Non-vascDESSCollagen type I hydrogels were prepared as previously described [2]. In total 1 ×105 of cells (EC and fibroblasts 1:1) were resuspended in 1 mL of collagen gel. The gelswere placed in 6-well cell culture inserts with membranes of 3.0 µm pore-size (BD Falcon,Kaiserslauten, Germany) and kept for 30 min at 37 ◦C in a humidified incubator containing5% CO2. After the polymerization period, EGM-2MV (Lonza, Basel, Switzerland) wasadded to the upper and lower chambers of the well/insert and hydrogels were incubatedfor two weeks. Then, hydrogels were covered by keratinocytes (7.5 × 104/gel), culturedfor an additional week, and transplanted onto immuno-incompetent rats [2].2.9. Transplantation of Tissue-Engineered Skin SubstitutesThe surgical protocol was approved by the local Committee for Experimental AnimalResearch (Cantonal veterinary office Zurich, permission number ZH045/2019). Immuno-incompetent female nu/nu rats, eight to ten weeks old (Envigo, Horst, The Netherlands),were anesthetized by inhalation of 5% Isoflurane (Baxter, Volketswil, Switzerland) andmaintained by inhalation of 2.5% Isoflurane via mask. The dermo-epidermal skin substi-tutes were transplanted on full-thickness skin wounds created on the back of the rats.vascDESS and non-vascDESS (three independent donors for HDMEC each, n = 2rats per condition (n = 6 per condition: 1 and 3 weeks; in total 12 vascDESS and 12 non-vascDESS) were transplanted onto full-thickness skin defects prepared on the backs of therats. To prevent wound closure from the surrounding rat skin, custom-made steel rings (di-ameter 2.6 cm) were sutured into full-thickness skin defects using non-absorbable polyestersutures (Ethibond®, Ethicon, Raritan, NJ, USA). The transplants were then covered witha silicone foil (Silon-SES, BMS, New York, NY, USA), a polyurethane sponge (Ligasano,Ligamed, Innsbruck, Austria), a cohesive conforming bandage (Sincohaft, Theo Frey AG,Bern, Switzerland), and tape as a wound dressing. Dressing changes and photographicdocumentation were performed once per week. Animals were euthanized using carbondioxide and the transplanted skins analogs were harvested after 7 and 21 days by in totoexcision and processed for immunohistochemical analysis.Cells 2022, 11, 1055 7 of 272.10. Quantification of CD200 and CD200R on Blood and Lymphatic Capillaries In VivoCapillary profiles of immunofluorescently stained normal j/a and f human skin, non-vasc/vascDESS analogs, and rat tissue (lymph nodes) were quantified on 6–8 µm thickcryo-sections using Fiji image analysis software (ver. 1.53i, NIH). The entire view fieldregions at 10× magnification were counted (n = 12 vascDESS and n = 12 non-vascDESSin vivo biopsies). First, blood (CD31+Podo−) and lymphatic (CD31+Podo+) capillarieswere quantified in normal j/a and f human skin. Then, the CD200 expression was quantifiedon those blood and lymphatic capillaries in normal j/a and f human skin.For some experiments, CD31+CollIV+ or CD31+Podo+ were identified as blood orlymphatic capillaries, respectively. Further, CD200 expression was assessed on thoseblood CD31+CollIV+ or lymphatic CD31+Podo+ capillaries in human skin and vascDESS.Furthermore, human CD200R expression was assessed in human skin and in the humanCD90-positive dermis of non-vasc/vascDESS analogs.2.11. Statistical AnalysisAll results are reported as mean ± SD. Statistical analysis was performed with Graph-Pad Prism 4.0 (Graph Pad software, La Jolla, CA, USA). Comparison between two groupswas performed using the two-tailed unpaired Student’s t-test and between multiple groupsusing two-way ANOVA with Bonferroni multiple comparisons test.* indicates p-value 0.01 to 0.05 (significant)** indicates p-value 0.001 to 0.01 (very significant)*** indicates p < 0.001 (extremely significant)**** indicates p < 0.0001 (extremely significant)ns = not significant (p > 0.05)3. Results3.1. CD200 Is Expressed in Normal Human Juvenile/Adult and Fetal SkinThe distribution of CD200 ligand on capillaries was examined by immunofluorescencein normal human juvenile/adult (j/a) skin as well as in fetal (f) skin (Figure 1). To distin-guish between human blood and lymphatic capillaries, we stained them specifically withhuman CD31 (red, Figure 1a,b) and podoplanin (white, Figure 1a’,b’) antibody, respectively.The stainings of podoplanin/CD31-positive lymphatic capillaries in human j/a andf skin were further confirmed by immunofluorescence analysis for PROX1, which is anuclear lymphatic lineage marker (Supplementary Figure S1a–d). Therefore, podoplaninand PROX1 were used interchangeable as lymphatic markers for various analyses inthis study.Whereas blood capillaries of both j/a and f skin samples were only CD31-positive(empty arrows), lymphatic capillaries showed the expression of podoplanin, a lymphaticendothelium-specific marker, and a faint CD31 co-expression (white arrows). The overallquantification of capillaries located in the dermis of both skin types revealed a significantlyhigher number of blood capillaries (CD31+Podo−) as compared to the number of lym-phatic capillaries (CD31+Podo+) (Figure 1c). Specifically, in the j/a skin, blood capillariesconstituted 68.8 ± 13.0%, while lymphatic capillaries comprised 31.0 ± 10.6% of all capil-laries presented in this skin type (p < 0.0001). In fetal skin, blood capillaries represented73.0 ± 19.0%, whereas lymphatic capillaries counted for 27.0 ± 13.0% of all capillaries(p < 0.001).Further, we detected CD200 on CD31+Podo− blood capillaries and CD31+Podo+lymphatic capillaries in j/a (Figure 1a”’) as well as in f skin (Figure 1b”’). Quantificationrevealed an enhanced expression of CD200 on lymphatic (68 ± 73%) as compared to bloodcapillaries (16 ± 97%) in the dermis of j/a skin (p = 0.0004) (Figure 1d). By contrast, thedifferences between the CD200 expression on lymphatics (64 ± 5%) and blood capillaries(44 ± 8%) of fetal skin were not statistically significant (p = ns).Cells 2022, 11, 1055 8 of 27−μFigure 1. Evaluation of CD200 expression in normal human juvenile/adult and fetal skin. (a–a”’)Immunofluorescence triple staining of juvenile/adult (j/a) human skin with antibodies againstCD31 (a) for human blood capillaries (red), podoplanin (a’) depicting human lymphatic endothe-lium (white), and CD200 (a”) (green). (a”’) represents a merged confocal Z stack. Whereas bloodcapillaries stain only CD31+ (empty arrows), lymphatic capillaries are CD31+Podo+ (white arrows).Note the presence of blood capillaries (CD31+Podo−) which are mainly negative for CD200 (emptyarrows), as well as the presence of lymphatic capillaries (CD31+Podo+) showing the expression ofCD200 marker (white filled arrows). (b–b”’) Immunofluorescence triple staining of human fetal skin(f skin) against CD31 (b) delineating human blood capillaries (red), podoplanin (b’) depicting humanlymphatic capillaries (white), and CD200 (b”) (green). Note the presence of blood and lymphaticcapillaries expressing CD200 (empty and filled white arrows, respectively). (b”’) represents a mergedoverlay. (c) Quantification of blood and lymphatic capillaries in j/a and f skin. In the dermis of j/a,blood capillaries constitute approximately 68.8 ± 13%, whereas lymphatic endothelium represents31.0 ± 10.6% of all vessels present in this skin type (*** p < 0.0001). In the f skin, blood endotheliumcomprises 73.0 ± 19% while lymphatic vessels constitute 27.0 ± 13% of all capillaries (** p < 0.001).(d) Quantification of CD200 expression on blood and lymphatic capillaries of j/a or f skin. Notethe significantly higher expression of CD200 on j/a lymphatic capillaries as compared to the j/ablood capillaries (67.0 ± 16% vs. 14.0 ± 2.0%, respectively, *** p < 0.0001), whereas the expression ofCD200 was similar in blood and lymphatic capillaries of human f skin (44.0 ± 8.0% vs. 64.0 ± 5.0%,respectively, p = ns), n = 5 independent j/a and fetal skin donors each. Cell nuclei are stained withHoechst (blue). Scale bars 100 µm.Cells 2022, 11, 1055 9 of 273.2. CD200 Is Differently Expressed on j/a and Fetal HDMEC Populations In VitroFreshly isolated and in vitro cultured (P1) HDMEC derived from j/a and f skin wereanalyzed with regard to CD200 expression by flow cytometry (Figure 2). Human CD31 andpodoplanin antibodies were used to identify human blood and lymphatic microvascularendothelial cells. Further, the detailed gating strategy is described in SupplementaryFigure S2. Figure 2. Expression of CD200 on freshly isolated as well as in vitro cultured juvenile/adult and fetalHDMEC. (a) Flow cytometry analysis of freshly isolated HDMEC derived from j/a human skin. CD31Cells 2022, 11, 1055 10 of 27and podoplanin were used to discriminate between blood endothelial cells (BEC, CD31+Podo−)and lymphatic endothelial cells (LEC, CD31+Podo+). HDMEC obtained from freshly isolated j/acontained 60.13 ± 17.35% of j/aBEC. Note the presence of two distinct subpopulations of LECexpressing different levels of podoplanin, namely LEC PodoHigh, which comprise 26.8 ± 6.75%,as well as LEC PodoLow representing 11.5 ± 2.95% of all freshly isolated j/aHDMEC. (d,e) Flowcytometric analysis of CD200 expression in freshly isolated j/aBEC and PodoHigh and PodoLow LEC.Whereas only 12.91 ± 5.86% of freshly harvested j/aBEC stained positive for CD200, 58.73 ± 16.97%of all j/aLEC expressed this marker. Please note that LEC PodoHigh are almost entirely positive forCD200 (98.1 ± 15.6%) (b,e), while LEC PodoLow exhibit only a moderate expression of this marker(36.9 ± 5.1%) (p = 0.0041) (c,e). (f–i) Flow cytometric analysis of cultured HDMEC at passage 1 (P1)derived from j/a skin. Cultured j/aHDMEC contains approximately 67.5 ± 18.21% of BEC as wellas 31.8 ± 10.35% of LEC (f). Whereas 11.3 ± 2.0% of cultured j/aBEC exhibit CD200 expression(g,i), a significantly higher number of cultured j/aLEC was CD200-positive (48.7 ± 17.2, p < 0.0001)(h,i). (j–m) Flow cytometric analysis of cultured fHDMEC at (P1) consisting of 58.4 ± 17.4% offBEC and 41.6 ± 11.5 of fLEC. Further, 9.06 ± 2.0% of fBEC show the expression of CD200 (k,m),while 51.9 ± 15.7% of fLEC are positive for CD200 (l,m) (p < 0.0001). Two-way unpaired studentt-test with ns = not significant (p > 0.05); ** for p-value 0.001 to 0.01 (very significant); and *** forp < 0.001 (extremely significant) was used for statistical analysis, n = 5 independent j/a and fetal skindonors each.Flow cytometry analysis revealed the presence of CD31+Podo− blood endothelial cells(BEC) in the freshly isolated j/aHDMEC, which constitute 64.13 ± 11% of all HDMEC(Figure 2a). Further, we detected altogether 35.9 ± 8% CD31+Podo+ lymphatic endothelialcells (LEC) in the freshly isolated HDMEC fraction (Figure 2a).The expression of CD200 on freshly isolated j/aBEC was relatively low and accountedfor 12.9 ± 5.9%, whereas CD200 was detected on 58.73 ± 17% of all j/aLEC (p = 0.0004)(Figure 2d).Moreover, we observed the presence of two distinct subpopulations of CD31+Podo+lymphatic endothelial cells (LEC) in the freshly isolated j/aHDMEC, which were character-ized by the different expression levels of podoplanin, namely LEC PodoHigh (25.4 ± 7.2%)as well as LEC PodoLow (10.5 ± 2.4%) (Figure 2a). Further analysis showed that LECPodoHigh are almost entirely positive for CD200 (98.8 ± 15.6%) (Figure 2b,e), whereas LECPodoLow displayed a significantly reduced expression of CD200 (36.9 ± 5.1%) (Figure 2c,e).Freshly isolated j/aHDMEC were further cultured in vitro and flow cytometric anal-yses regarding CD200 expression were repeated on HDMEC passage 1 (P1, cells afterfirst passage) cells. Accordingly, we identified approximately 66.7 ± 16.2% of BEC and33.3 ± 7.5% of LEC in cultured j/a P1 HDMEC. Further, we identified only a weak ex-pression of CD200 on BEC (11.3 ± 2%), whereas the expression of CD200 on LEC wassignificantly enhanced and accounted for 48.7 ± 17.2% (p < 0.0001) (Figure 2i). The LECPodoLow population was lost in cultured LEC already at P1.Due to the small size of human fetal skin biopsies and, thus, low numbers of HDMECin the total dermal cell mixture, the flow cytometry analysis of freshly isolated fetal en-dothelial cells was not possible. The analysis of cultured fetal P1 HDMEC revealed thatfBEC (fetal BEC) constituted approximately 58.9 ± 12.5% of all endothelial cells and thatonly 9.06 ± 2.0% of fBEC showed the expression of CD200 (Figure 2j–m). By contrast,fLEC (fetal LEC) represented approximately 41.1 ± 9.3% of all fHDMEC and 51.9 ± 15.7%of those cells expressed CD200 marker (Figure 2j–m). Thus, the CD200 expression wassignificantly enhanced on fLEC as compared to fBEC (p < 0.0001) (Figure 2m).The presence of the two subpopulations, namely LEC PodoHigh and LEC PodoLow,were almost undetectable on cultured (in vitro expanded) j/a and fHDMEC at P1 in vitro,and, therefore, not further analyzed.Cells 2022, 11, 1055 11 of 273.3. CD200+ LEC Demonstrate Higher Proliferation Rate Than CD200− LEC and BEC In VitroCD200+ LECs and CD200− LECs as well as donor-matched BEC derived and culturedfrom j/a and f skin were separated by fluorescence activated cell sorting (FACS) and usedfor colorimetric cell counting assay in vitro (Figure 3a). Proliferation assay using cellsderived from j/a skin samples revealed the highest proliferation rate of j/aCD200+ LECin the first 5 days of the analysis (Figure 3a, violet line) as compared to j/aCD200− LEC(green line; d1/d5: p > 0.05 (ns); d3: p < 0.05) and BEC (red line; j/aBEC vs. j/aCD200+LEC: d1/d3: 0.05 (ns); d5: p < 0.01). Interestingly, from day 7–11 during the proliferationassay, the population of j/aCD200+ LEC demonstrated a lower cycling rate as compared toj/aCD200− LEC and j/aBEC. Two-way ANOVA comparison demonstrated the followingsignificance: d7–d11: p < 0.001 (j/aCD200+ vs. j/aCD200− LEC) and d7–d11: p < 0.001(j/aBEC vs. j/aCD200+ LEC).−−Figure 3. Proliferation rate of juvenille/adult (j/a) and fetal (f) CD200+/− LEC and BEC in vitro.(a) Graphical representation of proliferation rates of CD200+ and CD200− BEC and LEC isolated fromCells 2022, 11, 1055 12 of 27j/a skin samples. Cells were plated at a concentration of 5 × 103 cells per well (6-well plate), and theirnumbers were determined up to 11 days after plating by colorimetric cell counting assay. J/aCD200+LEC (violet line) showed a higher proliferation rate in the first 5 days of the measurement as comparedto j/aCD200− LEC (green line) and j/aBEC (red line). In turn, from day 7–11 during the assay, j/aBECshowed the highest cycling rate. At the same time, j/aCD200+ LEC showed lower proliferation rate asj/aCD200− LEC. Two-way ANOVA (analysis of variance) comparison of those two cell populationsrevealed following significance: d1/d5: p > 0.05 (ns); d3: p < 0.05; d7–d11: p < 0.001), whereas thecomparison of j/aBEC vs. j/aCD200+ LEC demonstrated following values: d1/d3: 0.05 (ns); d5:p < 0.01; d7–d11: p < 0.001. (b) In days 1–5 of the assay, fCD200+ LEC (violet line) isolated from fetalskin revealed a slightly slower proliferation rate of as compared to fCD200− LEC (green line; d1/d5:p > 0.05 (ns); d3: p < 0.05), however it was higher as compared to fBEC (d1–d3: p > 0.05 (ns); d5p < 0.01). Further, from day 5–11 the fCD200+ LEC population demonstrated the highest cycling rateas compared to fCD200− LEC (d5: p > 0.05 (ns); d7–d11: p < 0.001) and to fBEC (d5: p < 0.01; d7–d11:p < 0.001). Thus, fBEC showed a moderate proliferation rate with cycling values ranging betweenfCD200+ LEC and fCD200− LEC within days 5–11 of the assay. A representative experiment out ofn = 6 (j/a) and n = 3 (f) is shown (n = different biological samples performed in triplicates). Two-wayANOVA with Bonferroni multiple comparisons test with ns = not significant (p > 0.05); * for p-value0.01 to 0.05 (significant); *** for p < 0.001 (extremely significant) was used for statistical analysis(green means CD200+ LEC/CD200− LEC comparison; violet means CD200+ vs. BEC comparison).(c) Live-dead assay assessing viability at a 2-day interval in primary j/aHDMEC containing BEC/LEC.The data shows high cell viability even after confluence is reached in monolayer HDMEC culture.(d) Clonogenic assay of CD200+ and CD200− lymphatic endothelial cells (LEC). Quantification of thenumber of colonies revealed that CD31+Podo+CD200+ formed 32 ± 11.0 and CD31+Podo+CD200−37.7 ± 2.08 (p = 0.4351, ns) lymphatic endothelial cells formed similar numbers of colonies 14 daysafter cell seeding. n = 3 independent skin donors each. Experiments were conducted in triplicates.Scale bar 100 µm.The proliferation assay of HDMEC isolated from fetal skin revealed a slightly slowerproliferation rate of fCD200+ LEC (violet line) as compared to fCD200− LEC (green line),whereas fCD200+ LEC proliferated faster than fBEC in days 1–5 of the assay (Figure 3b). Incontrast, from day 5–11 the fCD200+ LEC population demonstrated the highest cycling rateas compared to fCD200− LEC (d5: p > 0.05; d7–d11: p < 0.001) and to fBEC (d5: p < 0.001).Thus, fBEC showed a moderate proliferation rate with cycling values ranging betweenfCD200+ LEC and fCD200− LEC within days 5–11 of the assay.Cell viability stainings performed on primary j/aHDMECs containing both BECand LEC populations showed high cell viability throughout the 11-day culturing period(Figure 3c). In addition, Ki67 staining indicates that the fraction of Ki67+ cells was athighest at day 9, after which the number of proliferative cells decreased again (Figure 3c).Thus, metabolic activity is a leading indicator of proliferation, preceding cell division.Further, Wakabayashi et al. identified CD200+ as one of the markers of mouse tissue-resident vascular endothelial stem cells with enhanced clonal expansion potential [40].To investigate those characteristics in human j/a CD200+ and CD200− LEC used in thisstudy, we performed colony-forming assays (Figure 3d). The quantification revealed thatj/aCD200+ LEC formed 32 ± 11.0 of colonies and j/aCD200− LEC 37.7 ± 2.08 colonieson collagen I-coated dishes. Accordingly, both j/aCD200+/CD200− LEC fractions demon-strated a similar colony-forming ability (p = 0.4351).3.4. Specific Adhesion Molecules, Lymphatic Markers, and Chemokines Are Differently Expressedin Distinct HDMEC Populations In VitroTo determine the gene expression in different j/aHDMEC populations, cells wereharvested, cultured, separated at P0 into CD200−/CD200+ LEC and CD200− BEC fractions,and used for qRT-PCR analysis. Gene expression levels were normalized to GAPDH andexpression levels of each sample were calculated relative to the CD200-BEC population.Cells 2022, 11, 1055 13 of 27We did not use fibroblasts at all for any kind of normalization or in general in this analysis(Figure 4).−−−−−−−Figure 4. Gene expression analysis in distinct LEC and BEC fractions. HDMEC were harvestedfrom j/a skin, cultured, separated at P0 into CD200−/CD200+ LEC and CD200− BEC fractionsand used directly for qRT-PCR. The relative gene expression levels were normalized to GAPDHhousekeeping gene and displayed relative to CD200− BEC samples. (a–c) Analysis of adhesionmolecules confirmed 11-fold upregulation of CD200 mRNA in j/aCD200+ LEC (31.70 ± 0.67) ascompared to j/aCD200− LEC (2.88 ± 0.6; p < 0.0001) and j/aCD200− BEC (1 ± 0.41; p < 0.0001) (a).Another adhesion molecule, CD157 was also enriched in j/aCD200+ LEC (4.44 ± 0.48) as compared toj/aCD200− LEC (2.68 ± 0.54; p = 0.0107) and j/aCD200− BEC (1 ± 0.5; p = 0.0003) (b). The expressionof CD62P selectin mRNA was reduced in j/aCD200+ LEC (0.22 ± 0.09) in comparison to j/aCD200−LEC (0.43 ± 0.35; p = 0.5773, ns) and j/aCD200− BEC (1.0 ± 0.25; p = 0.0186) (c). (d,e) Assessment ofmRNA expression of lymphatic markers. J/aCD200+ LEC showed upregulated expression of PROX1(66.34 ± 0.74) and podoplanin (76.93 ± 0.77) as compared to j/aCD200− LEC (PROX1: 43.55 ± 0.78,podoplanin: 55.13 ± 0.76; both p < 0.0001) and j/aCD200− BEC (PROX1: 1 ± 0.41, podoplanin: 1 ± 0.09;Cells 2022, 11, 1055 14 of 27both p < 0.0001). (f,g) Chemokines CCL27 and CCL21 showed various mRNA expressions, whereasCCL27 mRNA was downregulated in j/aCD200+ LEC (2.32 ± 0.11), CCL27 mRNA was upregulatedin j/aCD200− LEC (9.96 ± 0.30; p < 0.0001) as compared to j/aCD200− BEC expression (1 ± 0.33;p = 0.0018). In contrast, CCL21 was significantly upregulated in j/aCD200+ LEC (19.86 ± 0.41),whereas CCL27 showed reduced mRNA levels in j/aCD200− LEC (11.17 ± 0.66; p < 0.0001). Eachbar represents mean ± SD of n = 3 biological samples. Experimental groups were compared usingone-way ANOVA with Turkey’s multiple comparisons test. Asterisks denote significance as follows:* p < 0.05; ** p < 0.01; *** p < 0.001; and **** p < 0.0001.Notably, we confirmed the 11-fold enhanced mRNA expression of CD200 in j/aCD200+LEC (31.70 ± 0.67) as compared to j/aCD200− LEC (2.88 ± 0.6; p < 0.0001) and j/aCD200−BEC (1 ± 0.41; p < 0.0001) (Figure 4a). Another adhesion molecule, CD157 was alsoenriched in j/aCD200+ LEC (4.44 ± 0.48) as compared to j/aCD200− LEC (2.68 ± 0.54;p = 0.0107) and j/aCD200− BEC (1 ± 0.5; p = 0.0003) (Figure 4b). However, the expressionof CD62P selectin mRNA was reduced in j/aCD200+ LEC (0.22 ± 0.09), whereas it wasenhanced in j/aCD200− LEC (0.43 ± 0.35; p = 0.5773, ns) and normalized to j/aCD200−BEC (1.0 ± 0.25; p = 0.0186) (Figure 4c). The expression of other adhesion molecules such asCD54, intercellular adhesion molecule 2 (ICAM2; CD102), vascular cell adhesion molecule1 (VCAM-1; CD106), and junctional adhesion molecule A (CD321; F11R) did not showsignificant differences between different endothelial cell populations (data not shown).Further, assessment of mRNA expression of PROX1 and podoplanin revealed upreg-ulation of both markers in j/aCD200+ LEC (66.34 ± 0.74 and 76.93 ± 0.77, respectively)(Figure 4d,e). In contrast, PROX1 (43.55 ± 0.78; p < 0.0001) and podoplanin (55.13 ± 0.76;p < 0.0001) mRNA was significantly reduced in j/aCD200− LEC, and the lowest expressionwas detected in j/aCD200− BEC (PROX1: 1 ± 0.41; p < 0.0001, podoplanin: 1 ± 0.09;p < 0.0001).Moreover, we investigated the expression of chemokines like CCL21 and CCL27 onthe mRNA level (Figure 4f,g). Whereas CCL21 was significantly upregulated in j/aCD200+LEC (19.86 ± 0.41), reduced mRNA levels were observed in j/aCD200− LEC (11.17 ± 0.66;p < 0.0001) and j/aCD200− BEC (1 ± 0.25; p < 0.0001) (Figure 4f). In contrast, CCL27mRNA expression was downregulated in j/aCD200+ LEC (2.32 ± 0.11), whereas CCL27gene expression was upregulated in j/aCD200− LEC (9.96 ± 0.30; p < 0.0001) relative toj/aCD200−BEC 1 ± 0.33 (p = 0.0018) (Figure 4g).3.5. CD200R Is Expressed on Distinct Subsets of Human and Rat Immune CellsAs CD200R is involved in immunosuppressive activity during skin inflammation andwas shown to improve graft take and survival [41], we sought to determine the expressionof CD200R in distinct subsets of human and rat immune cells.CD200R expression on immune cells isolated from human peripheral blood (PBMC)was first verified by FACS, and then respective cells were sorted (Supplementary Figure S4).Accordingly, granulocytes were gated by side scatter first, and then assessed for CD11b(integrin alpha M), CD15, and CD200R marker expression to separate a population ofCD11b+CD15+CD200+ granulocytes [42]. This granulocyte fraction was also positive forpan-granulocyte marker HIS48 (data not shown). The analysis revealed that 70% ± 15.7of human blood granulocytes demonstrated CD200R+ expression (n = 3 blood donors)(Supplementary Figure S4a,a”).Further, using low forward/side scatter and CD3 marker present at all stages of T-cell development, we identified a population of CD3+ T-cells in human blood PBMC [43](Supplementary Figure S4b,b”). The T cells demonstrated a high expression of CD200R,which accounted for 95% ± 22.5 of this subset. This subset also contained human naturalkiller T-cells (NKT) characterized by the co-expression of CD3+CD56+.Cells 2022, 11, 1055 15 of 27In addition, a human monocyte subset gated also on low forward/side scatter andon CD14 marker was identified in human blood PBMC (Supplementary Figure S4c,c’).In detail, we detected two populations of CD14+ blood cells: classical CD14+CD16− andnon-classical CD14+CD16+ monocytes that expressed CD200R. The mean expression ofCD200R was similar on both classical CD14+CD16− monocytes (75% ± 19.2) (Supplemen-tary Figure S4c”) and on non-classical CD14+CD16+ monocytes (70% ± 15.5).Further, the distribution of CD200R was assessed on immune cells in rat lymph nodes.We detected the CD200R expression on rat myeloid cells using rat-specific pan-myeloidantibody (Supplementary Figure S9a–c). Moreover, HIS48-positive rat granulocytes andCD68-expressing monocytes/macrophages were also positive for CD200R in native ratlymph nodes (Supplementary Figure S9d–i, respectively).3.6. Role of CD200 and CD200R in Endothelial-Immune Cell–Cell Interactions In VitroThe interaction of the CD200 ligand with CD200R expressing immune cells was furtherinvestigated using a cell adhesion assay (Figure 5). Distinct EC populations like j/aCD200+and CD200− LECs and HUVEC were co-cultured with human blood-derived granulocytesand/or T cells and visualized using confocal microscopy. We confirmed that HUVEC wereCD31+ but completely lacked the expression of podoplanin (Supplementary Figure S6a,a’),resembling the expression pattern of dermal BEC fraction. In addition, HUVEC lacked theexpression of CD200 and, therefore, were used as a negative control for the cell adhesionassay (Supplementary Figure S5b,b’).Initially, different endothelial cell fractions: j/aCD200+ and CD200- LEC and HU-VEC, were labeled using red cell tracker (red) and co-cultured with human blood-derivedgranulocytes or T-cells labeled with a green cell tracker and co-cultured (Figure 5a–c). Thequantification of the ratio of immune cells to endothelial cells demonstrated that only afew CD200R+ granulocytes (9.77 ± 2.5) and T-cells (4.27 ± 1.59; p = 0.99 (ns) adhered toHUVEC in the co-culture assay (Figure 5a). Similarly, only a few granulocytes (11.11 ± 3.19;p = 0.99) and T-cells (11.84 ± 0.93; p = 0.99) adhered to the j/aCD200− LEC (Figure 5b)as compared to HUVEC. In contrast, a high number of CD200R-expressing granulocytes(91.27 ± 31.71; p = 0.0005) and T-cells (115.22 ± 29.69; p < 0.0001) adhered specifically toj/aCD200+ LEC (Figure 5c) as compared to j/aCD200− LEC. The results show evidencethat CD200R-expressing immune cells demonstrated specific adhesion only to monolayersof endothelial cells expressing CD200 ligand, whereas almost no binding was detectedusing CD200− endothelial cells. Furthermore, there was no significant difference betweenthe adhesion of granulocytes and T-cells to different EC fractions.Involvement of endothelial CD200 in the cell–cell interactions between immune cells(blood-derived T-cells) and the endothelium was further investigated by pre-incubationof primary HDMEC with anti-CD200 antibody to block the CD200 epitopes (Supplemen-tary Figure S6). IgG1 treated and untreated HDMEC were used as a negative control.CD200 antibody treatment revealed that the adhesion of blood T-cells on the HDMECmonolayer was almost totally blocked by the antibody pre-incubation with the endothelialcells (9.4% ± 3.4), whereas IgG treatment (110.8% ± 27.6) and no treatment (119.7% ± 14.2)demonstrated significantly higher immune-cell binding. The blocking efficiency of CD200was verified using immunofluorescence staining of adherent HDMEC previously blockedwith unconjugated CD200 and subsequently stained with conjugated CD200 of the sameclone (Supplementary Figure S7).Cells 2022, 11, 1055 16 of 27−− μFigure 5. Cell adhesion assay of human immune cells to distinct endothelial cell (EC) populations.(a–c) HUVEC (CD200−) (a), j/aCD200− (b), and j/aCD200+ LEC (c) (all pre-labeled red) wereco-cultured with separated human blood-derived granulocytes and T-cells (all pre-labeled green).(d) Cell adhesion assay shows a decreased population of pre-labeled human granulocytes and T-cellscells adhering to both CD200− cells: HUVEC (a) and j/aLEC (b) as compared to the high binding ofboth immune cell types to j/aCD200+ LEC (c) in vitro. (d) The quantification of the ratio of immunecells to EC confirmed that human blood-derived granulocytes and T-cells demonstrated specificadherence to j/aCD200+ LEC, whereas those immune cells did not show adherence to CD200−EC. Accordingly, the assessed adhesion ratio of CD200R+ granulocytes (9.77 ± 2.58) and T-cells(4.27 ± 1.59; p = 0.99 (ns)) to HUVEC was low and similar to the binding ratio to j/aCD200− LEC(11.11 ± 3.19 and 11.84 ± 0.93; p = 0.99 and p = 0.99 (ns), respectively). Further, the data showedthat the adhesion rate of both immune cell types was significantly enhanced for j/aCD200+ LEC(91.27 ± 31.71 and 115.22 ± 29.69; p = 0.0005 and p < 0.0001, respectively). The results are expressed asmean ± SD from n = 6 biological samples of EC populations and n = 3 PBMC donors of granulocytesand T-cells. Asterisks denote significance as follows (unpaired t-test): *** p < 0.001. An unpaired t-testwas used. Cell nuclei are stained with Hoechst (blue). Scale bars: 100 µm.3.7. CD200 Is Expressed on Cultured Capillaries in 3D Hydrogels In VitroTo analyze the expression of CD200 on capillaries cultured in vitro, we used a 3Dcollagen I hydrogel-based system (Figure 6a–d). J/a human dermal microvascular endothe-lial cells (HDMEC) co-culture with dermal fibroblasts developed spontaneously into 3Dvascular networks in vitro. Notably, we were able to reproduce the physiological ratioof approximately 70:30% of lymphatic to blood capillaries in vitro as demonstrated byCD31 and Prox1 or LYVE1 markers using immunofluorescence whole-mount stainings of3D hydrogels (Figure 6a,b). Furthermore, we detected CD200 expression on both blood(CD31+PROX1−) and lymphatic (CD31+PROX1+) capillaries (Figure 6c, respectively). How-ever, similar to the j/a human skin, the expression of CD200 was enhanced on lymphatic ascompared to blood capillaries.Cells 2022, 11, 1055 17 of 27Figure 6. Expression of CD200 on in vitro cultured blood and lymphatic capillaries in 3D collagen.(a) Collagen type I-based hydrogel, and stained for endothelial-specific marker CD31 (red) andlymphatic lineage marker PROX1 (green) (n = 5). Whereas double-positive CD31+PROX1+ capillariesrepresent lymphatics, single positive CD31+PROX1− demonstrate blood capillaries. The lowerinset shows a higher magnification of the single nuclear PROX1 staining in lymphatic capillaries(arrows). (b) The merged confocal immunofluorescence showing CD31+ blood capillaries (red) andlymphatic capillaries positive for CD31+ (red) and LYVE1 (green), which is a lymphatic-specificmarker. Insets show a magnification of single-stained LYVE1 lymphatic capillaries. (c) Triple stainedimage of human capillary network co-stained for PROX1+ (green) CD200+ (white) CD31+ (red).Accordingly, PROX1+CD200+CD31+.triple positive capillaries represent lymphatics expressing CD200marker (filled arrows), whereas double-positive PROX1−CD200+CD31+ staining demonstrates bloodcapillaries positive for CD200 (empty arrows). (d) Triple co-staining for LYVE1+ (green) CD200+(white) CD31+ (red). Whereas the majority of lymphatic capillaries (CD31+LYVE1+) were positive forCD200 (filled arrow), only a few blood capillaries (CD31+LYVE1−) expressed CD200 (empty arrows).The results are representative from n = 3 biological samples of EC populations. Cell nuclei are stainedwith Hoechst (blue). Scale bars: (a–d): 50 µm.Cells 2022, 11, 1055 18 of 27These findings were conformed using another lymphatic marker, namely LYVE1(Figure 6b,d). A triple co-staining for LYVE1, CD200, and CD31 demonstrated that themajority of lymphatic capillaries (CD31+LYVE1+) were positive for CD200, whereas only afew blood capillaries (CD31+LYVE1−) expressed CD200.3.8. CD200 Is Expressed on Capillaries of Human Prevascularized DESS In VivoAs demonstrated on microvasculature in human skin, CD200 is specifically expressedon lymphatic rather than on blood capillaries (Figure 1 and Supplementary Figure S8). Sincepodoplanin (Podo) expression was restricted to lymphatics (Figure 1), we used podoplaninto delineate specifically lymphatic capillaries (Figure 7a and Supplementary Figure S8b)and IV (Coll IV) to detect only blood capillaries of human j/a skin and DESS in vivo(Figure 7b and Supplementary Figure S7c). In contrast to lymphatic endothelia, bloodcapillaries demonstrate a continuous basement membrane expressing Coll IV (Figure 7band Supplementary Figure S7c).Further, using those markers, we assessed the expression of CD200 on human lymphaticand blood capillaries of vascDESS in vivo (Figure 7c–d,f). Human vascDESS demonstrateda heterogeneous distribution pattern of human CD200, which was restricted to capillariesin the dermis, similar to the pattern observed in normal human skin (Figure 7a–d). Thequantification performed three weeks after transplantation revealed that CD200 was highlyexpressed on human podo-positive lymphatic capillaries (41.67 ± 5.89), whereas it wasonly scarcely detected on human Coll IV-positive blood capillaries (8.63 ± 2.95; p < 0.0001)(Figure 7c–d,f). Thus, like in human skin, CD200 showed a 4-fold higher expression onlymphatic as compared to blood capillaries in vascDESS.3.9. CD200 Binds to Its Cognitive Receptor, CD200R in Human Skin and Skin Substitutes In VivoInvolvement of human endothelial CD200 in the cell–cell interactions between theendothelium and CD200R+ immune cells has not been investigated so far in human skin.Therefore, we sought to determine the spatiotemporal interaction between CD200R-expressing cells with CD200 in normal human skin, non-vascularized DESS (control), andvascularized DESS (vascDESS) at one and three weeks after transplantation (Figure 8). Fur-ther, we have confirmed that rat CD200R+ cells were of myeloid origin, thus co-expressingmyeloid, granulocytes, and monocyte/macrophage-specific markers in rat tissue (Supple-mentary Figure S4).Whereas only a few CD200R-positive cells were detected in normal human j/a skin9.65 ± 3.56 (Figure 8a,a’,f), most CD200R-expressing cells were located in close proximityto capillaries as demonstrated by a co-staining for human CD31 (Figure 8a,a’, arrows).Similar, non-prevascularized (non-vasc) DESS also showed only a scarce number ofCD200R+ cells within the human dermal compartment at one week (4 ± 1.55, p = 0.1551 vs.normal skin) and at three weeks (2.67 ± 1.55, p = 0.0565 vs. normal skin) after transplanta-tion (Figure 8b–d).In contrast, human vascDESS containing human blood and lymphatic capillariesdemonstrated enhanced density of rat CD200R-positive cells at 1 week (26.5 ± 7.71,p < 0.0001 vs. non-vascDESS 1w, p < 0.0001 vs. human skin) and three weeks (21.31 ± 5.4,p < 0.0001 vs. non-vascDESS 1w, p < 0.0001 vs. human skin) in vivo (Figure 8d,e). Althoughdermal cells positive for CD200R were distributed throughout the entire dermal layer (Fig-ure 8d), the major subset of those cells adhered to CD200-positive endothelia (Figure 8d,e;arrows), demonstrating an active CD200–CD200R axis in vascDESS at 1 and 3 weekspost-transplantation. In particular, after 1w of in vivo culturing time, significantly moreCD200R+ cells were associated with CD200+ endothelial cells compared to cells that werenot in close proximity (18.8 ± 3.4 vs. 11.4 ± 2.1, p < 0.0001). This difference disappearedand there was a similar number of CD200R+ T cells was found associated (13.3 ± 2.0) andnon-associated with CD200-positive endothelial cells (11.9 ± 2.3, p = 0.2064).Cells 2022, 11, 1055 19 of 27Figure 7. Quantification of CD200 expression in transplanted vascDESS. (a,b) Immunofluorescenceco-staining of j/a human skin against huCD200 (green) and huPodoplanin (a) or collagen IV (b).Podoplanin depicts human lymphatic endothelium, while collagen IV is expressed exclusivelyaround human blood capillaries. White arrows in magnification insets indicate double-positivemicrovascular structures. (c,d) Immunoflorescence co-staining of vascDESS against huCD200 (green)as well as huPodoplanin (red), visualizing the human lymphatic capillaries (c) and huCollagenIV (red) depicting the human blood endothelium (d). (e) Quantification revealed that vascDESScontains a significantly higher number of blood (66.59 ± 20.95) than lymphatic capillaries (32 ± 8.34;** p = 0.009). Presented values are the mean (±SD) of total numbers of human CD31+ or podoplanin+vessels counted per 10× high-power field, n = 6 biological samples in each group. White arrows inmagnification insets indicate double-positive microvascular structures. (f) Quantification of CD200expression on blood and lymphatic vessels in vascDESS. Please note that CD200 is expressed mainlyon the lymphatic vessels (41.67 ± 5.89), while blood vessels exhibit only minor expression of thatmarker (8.63 ± 2.95; **** p < 0.0001). The results are expressed as mean ± SD from n = 3 biologicaldonors from 3 independent animal transplantation (6 animals in total). Cell nuclei are stained withHoechst (blue). Scale bars 50 µm.Cells 2022, 11, 1055 20 of 27μFigure 8. Expression of CD200R in human j/a skin as well as in non-vascDESS and vascDESS.(a,a’) Immunofluorescence pictures of j/a skin stained against CD31 (red) and CD200R (green). Notethat CD200R+ immune cells (9.65 ± 3.56) are closely associated with CD31+ capillaries. (b,c) Theexpression of CD200R in non-vascDESS at one week (4 ± 1.55, p = 0.1551 vs. normal skin) (b) and3 weeks (2.67 ± 1.55, p = 0.0565 vs. normal skin) (c) after transplantation. Once again, CD200R-expressing cells were located in close proximity to the CD31+ capillaries. (d,e) The expression ofCD200R in vascDESS one week (26.5 ± 7.71, p < 0.0001 vs. non-vascDESS 1w, **** p < 0.0001 vs.human skin) (d) and three weeks (21.31 ± 5.4, p < 0.0001 vs. non-vascDESS 1w, p < 0.0001 vs. humanskin) (e) post-transplantation. Numerous CD200R+ cells were visible throughout the entire dermallayer and adhered mainly to the CD200+ endothelium. (f) Quantification of CD200R-expressing cellsin the dermal compartments of j/a human skin as well as in non-vasc and vascDESS after one andCells 2022, 11, 1055 21 of 27three weeks in vivo. Please note the significantly higher number of CD200R+ cells in the dermis ofvascDESS, as compared to the native skin or non-vascDESS. In contrast, human vascDESS containinghuman blood and lymphatic capillaries demonstrated enhanced density of rat CD200R-positivecells at one (26.5 ± 7.71, p < 0.0001 vs. non-vascDESS one week, **** p < 0.0001 vs. human skin)and three (21.31 ± 5.4, **** p < 0.0001 vs. non-vascDESS 1w, p < 0.0001 vs. human skin) weeksin vivo (d,e). White arrows in magnification insets indicate CD200–CD200R interactions. (g) In vivo,significantly more CD200+ endothelial cells were associated with rat CD200R+ immune cells 1 wpost-transplantation compared to CD200R+ cells that were non-associated with CD200+ endothelialcells (**** p < 0.0001). This difference disappears after 3 w in vivo (ns, p > 0.05). The results areexpressed as mean ± SD from n = 3 biological donors from 3 independent animal transplantation(6 animals in total). Cell nuclei are stained with Hoechst (blue). Scale bars 100 µm and 50 µm(magnification insets).4. DiscussionUntil today, the distribution of endothelial CD200 and its interaction with CD200R hasnot been reported in human skin and tissue-engineered dermo-epidermal skin substitutes.In particular, we have shown that: (i) CD200 was differently expressed in blood andlymphatic capillaries, (ii) CD200R was primarily expressed by myeloid and T-cells, (iii)CD200R on myeloid cells interacts with its cognate CD200 ligand expressed on endothelialin vitro and in vivo. Overall, our study demonstrated that the active CD200–CD200R axisplays a crucial role during wound healing of skin substitutes in vivo. Certain aspects of thestudy deserve more careful consideration.We found that CD200 was abundantly expressed on small capillaries in normal humanskin and bioengineered human vascDESS in vivo, in particular on lymphatic rather thanblood capillaries of human skin and adipose tissue. This is in contrast to the study of Ko et al.that examined the distribution of endothelial CD200 in different types of vessels, includingsmall capillaries and large-diameter vessels in different rat organs except for skin [19].Whereas the authors described a pronounced CD200 immunoreactivity in small bloodcapillaries and almost no signal in arterioles and arteries, double labeling for CD200 andpodoplanin showed rather weak or undetectable expression on lymphatic endothelia [19].Interestingly, in our study, we detected an increased expression of CD200 on lymphaticendothelium in human skin and vascDESS as compared to blood capillaries. Thus, ourfindings might indicate that CD200 expression has some specific functions within humanlymphatics. Whereas the relative expression of CD200 on lymphatic capillaries in fetalskin was found to be comparable to the levels found in j/a skin, fetal blood capillariesshowed a markedly higher CD200 expression than their j/a counterpart. Using FACSon freshly isolated j/aHDMEC, we were able to confirm the relative CD200 expressionlevels in j/aBEC and j/aLEC also on a single-cell level. Re-analysis of previously unsortedHDMEC after a short culturing time (1 passage) revealed a slight decrease in relativeCD200 expression on j/aLEC and fLEC. In contrast, only minor changes were observablein j/a BEC.Moreover, Ko et al. [19] reported the distribution of CD200 protein in the rat endotheliaof veins and venules in vivo in the bone marrow and the spleen, whereas, in our study, wedid not observe CD200 on macrovascular EC derived from veins such as HUVEC on theprotein and mRNA level. This discrepancy may be due to obvious differences between ratand human skin and, therefore, it is not possible to directly compare the results of thosetwo studies. However, to the best of our knowledge, there is no report regarding CD200distribution in human skin.Another investigation performed by Wakabayashi et al. in mice detected the CD200expression in ECs of most organs, except in the liver [40]. Moreover, the authors deter-mined that CD200 was also co-expressed on all CD157+ ECs. Interestingly, CD157 wascharacterized in their study as a marker of tissue-resident vascular endothelial stem cells(VESC) with higher proliferative potential and clonal expansion than CD157−CD200−Cells 2022, 11, 1055 22 of 27ECs [40]. The mouse VESC described by Wakabayashi et al. were characterized by theirincreased proliferation rates as well as an enhanced colony-forming potential and theirability to differentiate into mature EC during wound healing [40].Although the authors did not investigate CD200 expression on human ECs, nor didthey distinguish between mouse blood and lymphatic endothelial cells [40], their studyimplies that CD200 might serve as a putative vascular stem cell marker also in humanECs. Thus, we performed clonogenic and proliferative assays in our study to assess apossible stem cell potential of CD200+ EC. However, we could not observe enhancedhomeostatic and regenerative stem cell properties using CD200+ as compared to CD200- ECsuggesting another possible function of CD200+ cells in human tissues. Therefore, furtherinvestigations are needed to validate the potential role of CD200+ human microvascularECs as VESC in human skin.It has been demonstrated that the specific expression of surface molecules is respon-sible for the trafficking of T-cells, monocytes/macrophages, and other leukocytes on theendothelium during tissue inflammation [44,45]. Further, pronounced CD200 immunore-activity has also been previously reported on the specialized endothelium of the highendothelial venule (HEV) in the rat lymph nodes [19]. HEV forms branching networksof highly spatially organized post-capillary venules recruiting and controlling the en-trance of lymphocytes from the bloodstream into lymph nodes. Following stimulationby antigen, activated lymphocytes exit the lymph node via lymphatics and re-enter thebloodstream [46]. Thus, the pronounced endothelial CD200 expression detected in HEVindicates that CD200–CD200R interaction may be involved in the regulation of immunecell trafficking in vivo.Additionally, we demonstrated the highest expression of CD200 on PodoHigh lym-phatic endothelial cells (LEC), whereas PodoLow LEC barely expressed this marker. Interest-ingly, PodoHigh LEC are restricted to lymphatic precollector vessels, whereas PodoLow LECare exclusively lining lymphatic capillaries. The heterogeneous distribution of endothelialCD200 among different sites of the lymphatic vascular bed indicates a possible function ofCD200+ PodoHigh lymphatic capillaries in the formation and maintaining of HEV. Indeed,previous studies demonstrated the crucial role of podoplanin expression in HEV integrityin an immune cell trafficking into the lymph nodes [47,48].Thus, the data obtained in this study indicate that CD200–CD200R interaction is criticalfor the proper function of the innate immune system by providing communication betweenCD200+ ECs and CD200R-expressing immune cells in HEV.Further, ECs lining human skin microvasculature are the first contact with most blood-borne cells, such as immune cells within the skin. In the present study, we examined theexpression and distribution of the CD200R, which is a cognate receptor of CD200. We foundCD200R on monocytes/macrophages, granulocytes, and T-cells in both rat and human skinas well as in tissue-engineered DESS. As previously reported CD200 binding to CD200Rexpressed mainly on CD11b+ myeloid cells, monocytes/macrophages, and dendritic cellsrepress their pro-inflammatory activation and interleukin production in vivo [14,15,49–51].This specific interaction inhibits MAP kinases p38, ERK, and JNK, the common signalingpathways involved in the classic activation of macrophages, theoretically maintaininganti-inflammatory M2 cells in their polarized state [52]. Further, previous studies inmice reported that the application of a specific anti CD200-immunoglobulin also inducedimmune tolerance in dendritic cells [53].Those results suggest that CD200–CD200R physical binding may have an importantrole and interactions in cell adhesion between immune cells and endothelium [19]. Weconfirmed here that CD200 expression in the skin microvasculature is indeed required forthe specific adhesion of blood-derived monocytes/macrophages and T-cells in vitro. Thesedata are in line with previous reports showing that anti-human CD200 antibodies com-pletely blocked the interaction between human T cells (Jurkat T cells) and ECs in vitro [19].Thus, together with previous reports, the data obtained in this study suggest a specific roleCells 2022, 11, 1055 23 of 27of CD200–CD200R in the downregulation of the immune system by blocking activatedmonocytes/macrophages and T-cells.Further, we detected a specific CD200–CD200R interaction in vascDESS in vivo. Inparticular, mainly lymphatic endothelial CD200+ interacted with CD200R. These data are inline with the observations of Ko et al. that showed that CD200–CD200R signaling mediatescell to cell interactions of immune cells with ECs in mouse tissues in vivo [19]. The samegroup also reported that CD200–CD200R signaling prevents further diapedesis in mousein vivo, and thus, it reduces tissue inflammation following injuries [19]. Moreover, as de-scribed by Ngwa et al., the CD200–CD200R signaling leads to potent immunosuppressionupon inflammatory stimuli [54]. Further, CD200 overexpression was shown to exert a pro-tective function in autoimmune inflammation in models of autoimmune encephalomyelitis(EAE) [15], autoimmune uveoretinitis (EAU) [22], collagen-induced arthritis [55], andinflammation-mediated neurodegeneration [56].Importantly, the interaction of CD200 with CD200R has been associated with a reducedrisk of graft rejection as well as prolonged transplantation survival in mice [41]. CD200 wasshown to be upregulated in mice transplantation models where successful inhibition of re-jection is accomplished and is believed to signal immunosuppression following engagementof a receptor, CD200R, on myeloid cells [57]. Upon binding, CD200:CD200R mediates analteration in cytokine production, with increased expression of anti-inflammatory cytokines:interleukin-4 (IL-4), IL-10 and transforming growth factor-β (TGF-β), and decreased IL-2,interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α) [58]. Moreover, in vitro incu-bation of allostimulated cells in the presence of CD200 leads to inhibition of cytotoxicT-lymphocytes (CTL) reaction; an effect was also seen following in vivo engraftment [49].Therefore, the interaction of CD200 with its CD200R is of pivotal importance for skintissue engineering. As such, the incorporation of CD200+ EC into prevascularized skinsubstitutes could prevent excessive inflammation by its immune-suppressive function, thusreducing the risk of graft rejection [19]. Accordingly, we reported previously improvedwound healing and graft take rate of vascDESS as compared to non-vascDESS [6–8,59,60].In these studies, we previously demonstrated enhanced graft rejection, delayed graft takeand prolonged pro-inflammatory M1 macrophage response in non-vascDESS compared tovascDESS, suggesting that the CD200–CD200R axis on EC/myeloid cells plays an importantrole in these outcomes [6–8,59,60] Our data are consistent with previous evidence fromHoek et al. that CD200 exerts an inhibitory function on myeloid cells [15], and thatoverexpression of CD200 signaling contributes to the polarization of cytokine productiontowards an anti-inflammatory, pro-regenerative cytokine profile [57].5. ConclusionsIn summary and conclusion, this appears to be the first report demonstrating thephysical interaction of CD200–CD200R in human skin and transplanted skin grafts. TheCD200 was present mainly on PodoHigh lymphatic pre-collectors, suggesting its specific rolein the regulation of immune cells trafficking. Importantly, CD200–CD200R is also highlyactive during wound healing of transplanted skin grafts. It appears likely that a similarinteraction between CD200 and CD200R will take place when autologous tissue-engineeredskin analogs are transplanted onto human patients. Further, these results implicate that theprevascularisation approach of skin substitutes allows proper cell–cell interactions in thewound bed leading to improved graft take and skin regeneration. Further investigationshould explore the function of CD200R+ myeloid cells and their interaction with CD200 inhuman skin transplants in more detail.Supplementary Materials: The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cells11061055/s1, Figure S1: Evaluation of the expression ofblood and lymphatic markers in normal human juvenile/adult (j/a) and fetal (f) skin; Figure S2:Gating strategy involved in the flow cytometry analysis of HDMEC; Figure S3: Gating strategyusing isotype controls; Figure S4: Expression of CD200R on human blood immune cells; Figure S5:Expression of CD200R in rat lymph nodes; Figure S6: Expression of CD31 and CD200 in HUVEC;Cells 2022, 11, 1055 24 of 27Figure S7: Expression of CD200 in normal a/j human skin. Figure S8: Expression of CD200 in normala/j human skin; Figure S9: Expression of CD200R in rat lymph nodes.Author Contributions: Conceptualization, A.S.K., D.R. and K.M.-M.; methodology, H.M., D.R. andK.M.-M.; software, H.M. and D.R., validation, D.R., K.M.-M. and A.S.K.; formal analysis, D.R.,K.M.-M. and A.S.K.; investigation, H.M.; resources, U.M.; data curation, D.R. writing—originaldraft preparation, K.M.-M., D.R. and A.S.K.; writing—review and editing, A.S.K., D.R. and T.B.;visualization, D.R. and D.Z.; supervision, A.S.K.; project administration, A.S.K., T.B. and U.M.funding acquisition, A.S.K. and U.M. All authors have read and agreed to the published version ofthe manuscript.Funding: This research was funded by ITN EU project SkinTERM under grant agreement no. 955722to A.S.K., Swiss National Science Foundation Sinergia project no CRSII5_173868 “A Tissue, Cell,and Molecular Approach to Understanding and Treating Microtia” to A.S.K and T.B., and SwissNational Science Foundation project grant 205321_179012 “Skin biomechanics and mechanobiologyfor wound healing and tissue engineering” to T.B. This work was supported by University of Zurich(SKINTEGRITY.CH collaborative research program). The authors are particularly grateful to theFoundation Gaydoul for their generous financial support. The funding sources did not participate inthe study design, the collection, analysis, and interpretation of data, the writing of the report, or thedecision to submit the article for publication.Institutional Review Board Statement: The study was conducted according to the Declaration ofHelsinki Principles and after permission by the Ethics Commission of the Canton Zurich: BASECNo. PB_2020-00066, BASEC No. 2018-00269). The animal study protocol was approved by the localCommittee for Experimental Animal Research (Cantonal veterinary office Zurich, permission numberZH045/2019).Informed Consent Statement: Informed consent was obtained from all subjects involved in the study.Data Availability Statement: The data that support the findings of this study are available on requestfrom the corresponding author.Conflicts of Interest: The authors declare no conflict of interest.References1. Biedermann, T.; Boettcher-Haberzeth, S.; Reichmann, E. Tissue Engineering of Skin for Wound Coverage. Eur. J. Pediatr. Surg.2013, 23, 375–382. [CrossRef] [PubMed]2. Biedermann, T.; Bottcher-Haberzeth, S.; Klar, A.S.; Widmer, D.S.; Pontiggia, L.; Weber, A.D.; Weber, D.M.; Schiestl, C.; Meuli, M.;Reichmann, E. The Influence of Stromal Cells on the Pigmentation of Tissue-Engineered Dermo-Epidermal Skin Grafts. TissueEng. Part A 2015, 21, 960–969. [CrossRef]3. Bottcher-Haberzeth, S.; Biedermann, T.; Klar, A.S.; Widmer, D.S.; Neuhaus, K.; Schiestl, C.; Meuli, M.; Reichmann, E. Char-acterization of pigmented dermo-epidermal skin substitutes in a long-term in vivo assay. Exp. Dermatol. 2015, 24, 16–21.[CrossRef]4. Bottcher-Haberzeth, S.; Klar, A.S.; Biedermann, T.; Schiestl, C.; Meuli-Simmen, C.; Reichmann, E.; Meuli, M. “Trooping the color”:Restoring the original donor skin color by addition of melanocytes to bioengineered skin analogs. Pediatr. Surg. Int. 2013, 29,239–247. [CrossRef] [PubMed]5. Klar, A.S.; Biedermann, T.; Michalak, K.; Michalczyk, T.; Meuli-Simmen, C.; Scherberich, A.; Meuli, M.; Reichmann, E. HumanAdipose Mesenchymal Cells Inhibit Melanocyte Differentiation and the Pigmentation of Human Skin via Increased Expression ofTGF-beta1. J. Invest. Dermatol. 2017, 137, 2560–2569. [CrossRef] [PubMed]6. Klar, A.S.; Guven, S.; Biedermann, T.; Luginbuhl, J.; Bottcher-Haberzeth, S.; Meuli-Simmen, C.; Meuli, M.; Martin, I.; Scherberich,A.; Reichmann, E. Tissue-engineered dermo-epidermal skin grafts prevascularized with adipose-derived cells. Biomaterials 2014,35, 5065–5078. [CrossRef]7. Klar, A.S.; Biedermann, T.; Simmen-Meuli, C.; Reichmann, E.; Meuli, M. Comparison of in vivo immune responses followingtransplantation of vascularized and non-vascularized human dermo-epidermal skin substitutes. Pediatr. Surg. Int. 2017, 33,377–382. [CrossRef]8. Klar, A.S.; Bottcher-Haberzeth, S.; Biedermann, T.; Michalak, K.; Kisiel, M.; Reichmann, E.; Meuli, M. Differential expressionof granulocyte, macrophage, and hypoxia markers during early and late wound healing stages following transplantation oftissue-engineered skin substitutes of human origin. Pediatr. Surg. Int. 2014, 30, 1257–1264. [CrossRef]9. Tremblay, P.L.; Hudon, V.; Berthod, F.; Germain, L.; Auger, F.A. Inosculation of tissue-engineered capillaries with the host'svasculature in a reconstructed skin transplanted on mice. Am. J. Transplant. 2005, 5, 1002–1010. [CrossRef]10. MacNeil, S. Progress and opportunities for tissue-engineered skin. Nature 2007, 445, 874–880. [CrossRef]Cells 2022, 11, 1055 25 of 2711. Marino, D.; Luginbuhl, J.; Scola, S.; Meuli, M.; Reichmann, E. Bioengineering dermo-epidermal skin grafts with blood andlymphatic capillaries. Sci. Transl. Med. 2014, 6, 221ra214. [CrossRef] [PubMed]12. Montano, I.; Schiestl, C.; Schneider, J.; Pontiggia, L.; Luginbuhl, J.; Biedermann, T.; Bottcher-Haberzeth, S.; Braziulis, E.; Meuli, M.;Reichmann, E. Formation of human capillaries in vitro: The engineering of prevascularized matrices. Tissue Eng. Part A 2010, 16,269–282. [CrossRef] [PubMed]13. Minas, K.; Liversidge, J. Is the CD200/CD200 receptor interaction more than just a myeloid cell lnhibitory signal? Crit. Rev.Immunol. 2006, 26, 213–230. [CrossRef] [PubMed]14. Gorczynski, R.; Chen, Z.; Kai, Y.; Lee, L.; Wong, S.; Marsden, P.A. CD200 is a ligand for all members of the CD200R family ofimmunoregulatory molecules. J. Immunol. 2004, 172, 7744–7749. [CrossRef]15. Hoek, R.M.; Ruuls, S.R.; Murphy, C.A.; Wright, G.J.; Goddard, R.; Zurawski, S.M.; Blom, B.; Homola, M.E.; Streit, W.J.; Brown,M.H.; et al. Down-regulation of the macrophage lineage through interaction with OX2 (CD200). Science 2000, 290, 1768–1771.[CrossRef] [PubMed]16. Copland, D.A.; Calder, C.J.; Raveney, B.J.; Nicholson, L.B.; Phillips, J.; Cherwinski, H.; Jenmalm, M.; Sedgwick, J.D.; Dick, A.D.Monoclonal antibody-mediated CD200 receptor signaling suppresses macrophage activation and tissue damage in experimentalautoimmune uveoretinitis. Am. J. Pathol. 2007, 171, 580–588. [CrossRef]17. Preston, S.; Wright, G.J.; Starr, K.; Barclay, A.N.; Brown, M.H. The leukocyte/neuron cell surface antigen OX2 binds to a ligand onmacrophages. Eur. J. Immunol. 1997, 27, 1911–1918. [CrossRef]18. Meuth, S.G.; Simon, O.J.; Grimm, A.; Melzer, N.; Herrmann, A.M.; Spitzer, P.; Landgraf, P.; Wiendl, H. CNS inflammation andneuronal degeneration is aggravated by impaired CD200-CD200R-mediated macrophage silencing. J. Neuroimmunol. 2008, 194,62–69. [CrossRef]19. Ko, Y.C.; Chien, H.F.; Jiang-Shieh, Y.F.; Chang, C.Y.; Pai, M.H.; Huang, J.P.; Chen, H.M.; Wu, C.H. Endothelial CD200 isheterogeneously distributed, regulated and involved in immune cell-endothelium interactions. J. Anat. 2009, 214, 183–195.[CrossRef]20. Rosenblum, M.D.; Olasz, E.B.; Yancey, K.B.; Woodliff, J.E.; Lazarova, Z.; Gerber, K.A.; Truitt, R.L. Expression of CD200 onepithelial cells of the murine hair follicle: A role in tissue-specific immune tolerance? J. Investig. Dermatol. 2004, 123, 880–887.[CrossRef]21. Wright, G.J.; Cherwinski, H.; Foster-Cuevas, M.; Brooke, G.; Puklavec, M.J.; Bigler, M.; Song, Y.; Jenmalm, M.; Gorman, D.;McClanahan, T.; et al. Characterization of the CD200 receptor family in mice and humans and their interactions with CD200. J.Immunol. 2003, 171, 3034–3046. [CrossRef] [PubMed]22. Broderick, C.; Hoek, R.M.; Forrester, J.V.; Liversidge, J.; Sedgwick, J.D.; Dick, A.D. Constitutive retinal CD200 expression regulatesresident microglia and activation state of inflammatory cells during experimental autoimmune uveoretinitis. Am. J. Pathol. 2002,161, 1669–1677. [CrossRef]23. Christine, A.; Vaine, R.J.S. Chapter Five—The CD200–CD200R1 Inhibitory Signaling Pathway: Immune Regulation and Host–Pathogen Interactions. Adv. Immunol. 2014, 121, 191–211. [CrossRef]24. Belkin, D.A.; Mitsui, H.; Wang, C.Q.; Gonzalez, J.; Zhang, S.; Shah, K.R.; Coats, I.; Suarez-Farinas, M.; Krueger, J.G.; Felsen,D.; et al. CD200 upregulation in vascular endothelium surrounding cutaneous squamous cell carcinoma. JAMA Dermatol. 2013,149, 178–186. [CrossRef]25. Stumpfova, M.; Ratner, D.; Desciak, E.B.; Eliezri, Y.D.; Owens, D.M. The Immunosuppressive Surface Ligand CD200 Augmentsthe Metastatic Capacity of Squamous Cell Carcinoma. Cancer Res. 2010, 70, 2962–2972. [CrossRef]26. Kretz-Rommel, A.; Qin, F.; Dakappagari, N.; Ravey, E.P.; McWhirter, J.; Oltean, D.; Frederickson, S.; Maruyama, T.; Wild, M.A.;Nolan, M.J.; et al. CD200 expression on tumor cells suppresses antitumor immunity: New approaches to cancer immunotherapy.J. Immunol. 2007, 178, 5595–5605. [CrossRef]27. Tonks, A.; Hills, R.; White, P.; Rosie, B.; Mills, K.I.; Burnett, A.K.; Darley, R.L. CD200 as a prognostic factor in acute myeloidleukaemia. Leukemia 2007, 21, 566–568. [CrossRef]28. Petermann, K.B.; Rozenberg, G.I.; Zedek, D.; Groben, P.; McKinnon, K.; Buehler, C.; Kim, W.Y.; Shields, J.M.; Penland, S.; Bear,J.E.; et al. CD200 is induced by ERK and is a potential therapeutic target in melanoma. J. Clin. Investig. 2007, 117, 3922–3929.[CrossRef]29. Moreaux, J.; Hose, D.; Reme, T.; Jourdan, E.; Hundemer, M.; Legouffe, E.; Moine, P.; Bourin, P.; Moos, M.; Corre, J.; et al. CD200 isa new prognostic factor in multiple myeloma. Blood 2006, 108, 4194–4197. [CrossRef]30. Schwartzfarb, E.; Kirsner, R.S. Understanding scarring: Scarless fetal wound healing as a model. J. Investig. Dermatol. 2012, 132,260. [CrossRef]31. Larson, B.J.; Longaker, M.T.; Lorenz, H.P. Scarless fetal wound healing: A basic science review. Plast. Reconstr. Surg. 2010, 126,1172–1180. [CrossRef] [PubMed]32. Walraven, M.; Talhout, W.; Beelen, R.H.; van Egmond, M.; Ulrich, M.M. Healthy human second-trimester fetal skin is deficient inleukocytes and associated homing chemokines. Wound Repair Regen. 2016, 24, 533–541. [CrossRef] [PubMed]33. Pontiggia, L.; Biedermann, T.; Meuli, M.; Widmer, D.; Bottcher-Haberzeth, S.; Schiestl, C.; Schneider, J.; Braziulis, E.; Montano,I.; Meuli-Simmen, C.; et al. Markers to evaluate the quality and self-renewing potential of engineered human skin substitutesin vitro and after transplantation. J. Investig. Dermatol. 2009, 129, 480–490. [CrossRef] [PubMed]34. Nolan, T.; Hands, R.E.; Bustin, S.A. Quantification of mRNA using real-time RT-PCR. Nat. Protoc. 2006, 1, 1559–1582. [CrossRef]Cells 2022, 11, 1055 26 of 2735. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [CrossRef]36. Rao, X.; Huang, X.; Zhou, Z.; Lin, X. An improvement of the 2ˆ(-delta delta CT) method for quantitative real-time polymerasechain reaction data analysis. Biostat. Bioinform. Biomath. 2013, 3, 71–85. [CrossRef]37. Svec, D.; Tichopad, A.; Novosadova, V.; Pfaffl, M.W.; Kubista, M. How good is a PCR efficiency estimate: Recommendations forprecise and robust qPCR efficiency assessments. Biomol. Detect. Quantif. 2015, 3, 9–16. [CrossRef]38. Illescas-Montes, R.; Melguizo-Rodriguez, L.; Garcia-Martinez, O.; de Luna-Bertos, E.; Manzano-Moreno, F.J.; Ruiz, C.; Ramos-Torrecillas, J. Human Fibroblast Gene Expression Modulation Using 940 NM Diode Laser. Sci. Rep. 2019, 9, 12037. [CrossRef]39. Pontikoglou, C.; Langonne, A.; Ba, M.A.; Varin, A.; Rosset, P.; Charbord, P.; Sensebe, L.; Deschaseaux, F. CD200 expression inhuman cultured bone marrow mesenchymal stem cells is induced by pro-osteogenic and pro-inflammatory cues. J. Cell. Mol.Med. 2016, 20, 655–665. [CrossRef]40. Wakabayashi, T.; Naito, H.; Suehiro, J.; Lin, Y.; Kawaji, H.; Iba, T.; Kouno, T.; Ishikawa-Kato, S.; Furuno, M.; Takara, K.; et al.CD157 Marks Tissue-Resident Endothelial Stem Cells with Homeostatic and Regenerative Properties. Cell Stem Cell 2018, 22,384–395. [CrossRef]41. Gorczynski, R.M.; Hadidi, S.; Yu, G.; Clark, D.A. The same immunoregulatory molecules contribute to successful pregnancy andtransplantation. Am. J. Reprod. Immunol. 2002, 48, 18–26. [CrossRef] [PubMed]42. Gustafson, M.P.; Lin, Y.; Maas, M.L.; Van Keulen, V.P.; Johnston, P.B.; Peikert, T.; Gastineau, D.A.; Dietz, A.B. A Methodfor Identification and Analysis of Non-Overlapping Myeloid Immunophenotypes in Humans. PLoS ONE 2015, 10, e0121546.[CrossRef]43. Pitcher, L.A.; van Oers, N.S.C. T-cell receptor signal transmission: Who gives an ITAM? Trends Immunol. 2003, 24, 554–560.[CrossRef] [PubMed]44. Miyasaka, M.; Tanaka, T. Lymphocyte trafficking across high endothelial venules: Dogmas and enigmas. Nat. Rev. Immunol. 2004,4, 360–370. [CrossRef] [PubMed]45. Luster, A.D.; Alon, R.; von Andrian, U.H. Immune cell migration in inflammation: Present and future therapeutic targets. Nat.Immunol. 2005, 6, 1182–1190. [CrossRef]46. Ruddle, N.H. High Endothelial Venules and Lymphatic Vessels in Tertiary Lymphoid Organs: Characteristics, Functions, andRegulation. Front. Immunol. 2016, 7, 491. [CrossRef]47. Acton, S.E.; Astarita, J.L.; Malhotra, D.; Lukacs-Kornek, V.; Franz, B.; Hess, P.R.; Jakus, Z.; Kuligowski, M.; Fletcher, A.L.; Elpek,K.G.; et al. Podoplanin-Rich Stromal Networks Induce Dendritic Cell Motility via Activation of the C-type Lectin ReceptorCLEC-2. Immunity 2012, 37, 276–289. [CrossRef]48. Herzog, B.H.; Fu, J.X.; Wilson, S.J.; Hess, P.R.; Sen, A.; McDaniel, J.M.; Pan, Y.F.; Sheng, M.J.; Yago, T.; Silasi-Mansat, R.; et al.Podoplanin maintains high endothelial venule integrity by interacting with platelet CLEC-2. Nature 2013, 502, 105–109. [CrossRef]49. Gorczynski, R.M.; Cattral, M.S.; Chen, Z.G.; Hu, J.A.; Lei, J.; Min, W.P.; Yu, G.; Ni, J. An immunoadhesin incorporating themolecule OX-2 is a potent immunosuppressant that prolongs allo- and xenograft survival. J. Immunol. 1999, 163, 1654–1660.[CrossRef]50. Koning, N.; van Eijk, M.; Pouwels, W.; Brouwer, M.S.M.; Voehringer, D.; Huitinga, I.; Hoek, R.M.; Raes, G.; Hamann, J. Expressionof the Inhibitory CD200 Receptor Is Associated with Alternative Macrophage Activation. J. Innate Immun. 2010, 2, 195–200.[CrossRef]51. Taylor, N.; McConnachie, K.; Calder, C.; Dawson, R.; Dick, A.; Sedgwick, J.D.; Liversidge, J. Enhanced tolerance to autoimmuneuveitis in CD200-deficient mice correlates with a pronounced Th2 switch in response to antigen challenge. J. Immunol. 2005,174, 3818. [CrossRef]52. Zhang, S.L.; Cherwinski, H.; Sedgwick, J.D.; Phillips, J.H. Molecular mechanisms of CD200 inhibition of mast cell activation. J.Immunol. 2004, 173, 6786–6793. [CrossRef]53. Fallarino, F.; Asselin-Paturel, C.; Vacca, C.; Bianchi, R.; Gizzi, S.; Fioretti, M.C.; Trinchieri, G.; Grohmann, U.; Puccetti, P. Murineplasmacytoid dendritic cells initiate the immunosuppressive pathway of tryptophan catabolism in response to CD200 receptorengagement. J. Immunol. 2004, 173, 3748–3754. [CrossRef]54. Ngwa, C.; Liu, F. CD200-CD200R signaling and diseases: A potential therapeutic target? Int. J. Physiol. Pathophysiol. Pharmacol.2019, 11, 297–309.55. Gorczynski, R.M.; Chen, Z.Q.; Yu, K.; Hu, J. CD200 immunoadhesin suppresses collagen-induced arthritis in mice. Clin. Immunol.2001, 101, 328–334. [CrossRef]56. Chitnis, T.; Imitola, J.; Wang, Y.; Elyaman, W.; Chawla, P.; Sharuk, M.; Raddassi, K.; Bronson, R.T.; Khoury, S.J. Elevated neuronalexpression of CD200 protects Wld(s) mice from inflammation-mediated neurodegeneration. Am. J. Pathol. 2007, 170, 1695–1712.[CrossRef]57. Wright, G.J.; Puklavec, M.J.; Willis, A.C.; Hoek, R.M.; Sedgwick, J.D.; Brown, M.H.; Barclay, A.N. Lymphoid/neuronal cell surfaceOX2 glycoprotein recognizes a novel receptor on macrophages implicated in the control of their function. Immunity 2000, 13,233–242. [CrossRef]58. Kotwica-Mojzych, K.; Jodlowska-Jedrych, B.; Mojzych, M. CD200:CD200R Interactions and Their Importance in Immunoregula-tion. Int. J. Mol. Sci. 2021, 22, 1602. [CrossRef]Cells 2022, 11, 1055 27 of 2759. Klar, A.S.; Guven, S.; Zimoch, J.; Zapiorkowska, N.A.; Biedermann, T.; Bottcher-Haberzeth, S.; Meuli-Simmen, C.; Martin, I.;Scherberich, A.; Reichmann, E.; et al. Characterization of vasculogenic potential of human adipose-derived endothelial cells in athree-dimensional vascularized skin substitute. Pediatr. Surg. Int. 2016, 32, 17–27. [CrossRef]60. Klar, A.S.; Michalak-Micka, K.; Biedermann, T.; Simmen-Meuli, C.; Reichmann, E.; Meuli, M. Characterization of M1 and M2polarization of macrophages in vascularized human dermo-epidermal skin substitutes in vivo. Pediatr. Surg. Int. 2018, 34,129–135. [CrossRef]

Published: 2013.10.25

Abstract

Extracted data

Published: 2013.10.25

Abstract

Extracted data

Related items

Related items