A cell-free system having high RNA and protein synthesizing activities was prepared from Escherichia coli Q 13. When the replicative form DNA of bacteriophage OX-174 was added to the system, remarkable stimulation of the RNA and protein synthesis was observed. The synthesized RNA was only hybridized with the "minus " strand of the replicative form DNA, showing that the nucleotide sequence of the minus strand was transcribed by RNA— polymerase. The protein synthesized in this system was identified by various methods, and it was demonstrated that the major product was the phage-coat protein. The significance of the above observations is discussed in relation to the mechanism of expression of the genetic information encoded in the ph...
AbstractThree 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAAC...
University of Minnesota Ph.D. dissertation. August 2012. Major: Physics. Advisor: Vincent Noireaux....
Polypeptide synthesis at high temperature directed by single strand DNA as a messen-ger was investig...
The RNA and proteins synthesized in an Escherichia coli cell-free system of protein synthesis direct...
A membranous cell-free system derived from Escherichia coli is described. When the system is primed ...
scherichia coli cells were treated with mitomycin C to suppress host DNA synthesis, infected for fiv...
The RNA and proteins synthesized in an Escherichia coli cell-free system of protein synthesis direct...
THE reproduction of RNA-containing bacteriophages is independent of host DNA and DNA-synthesis1–4. A...
Journal ArticleEven through the amino acids corresponding to most of the 64 nucleotide triplets are ...
Phage P4 DNA is replicated in cell-free extracts of Escherichia coli in the presence of partially pu...
Phage fd DNA complexed with DNA binding protein I was used by Escherichia coli RNA polymerase (nucle...
As a fast and reliable technology with applications in diverse biological studies, cell-free protein...
The RNA-based organisms from which modern life is thought to have descended would have depended on a...
The replication of bacteriophage phiX174 was analyzed in various Escherichia coli mutants carrying o...
The polypeptides synthesized in an E. coli cell-free system under the direction of the small RNA of ...
AbstractThree 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAAC...
University of Minnesota Ph.D. dissertation. August 2012. Major: Physics. Advisor: Vincent Noireaux....
Polypeptide synthesis at high temperature directed by single strand DNA as a messen-ger was investig...
The RNA and proteins synthesized in an Escherichia coli cell-free system of protein synthesis direct...
A membranous cell-free system derived from Escherichia coli is described. When the system is primed ...
scherichia coli cells were treated with mitomycin C to suppress host DNA synthesis, infected for fiv...
The RNA and proteins synthesized in an Escherichia coli cell-free system of protein synthesis direct...
THE reproduction of RNA-containing bacteriophages is independent of host DNA and DNA-synthesis1–4. A...
Journal ArticleEven through the amino acids corresponding to most of the 64 nucleotide triplets are ...
Phage P4 DNA is replicated in cell-free extracts of Escherichia coli in the presence of partially pu...
Phage fd DNA complexed with DNA binding protein I was used by Escherichia coli RNA polymerase (nucle...
As a fast and reliable technology with applications in diverse biological studies, cell-free protein...
The RNA-based organisms from which modern life is thought to have descended would have depended on a...
The replication of bacteriophage phiX174 was analyzed in various Escherichia coli mutants carrying o...
The polypeptides synthesized in an E. coli cell-free system under the direction of the small RNA of ...
AbstractThree 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAAC...
University of Minnesota Ph.D. dissertation. August 2012. Major: Physics. Advisor: Vincent Noireaux....
Polypeptide synthesis at high temperature directed by single strand DNA as a messen-ger was investig...