Characterization of the ungl mutation of Escherichia coli

Uracil DNA glycosylase (ung) excises uracil residues from DNA which arise as a result of either deamination of cytosine or misincorporation of dUMP residues by DNA polymerase. Ung mutants of E. coli e.g. BW310 (1) have a high rate of GC-AT mutations. An E. coli ung7strain also deficient in dUTPase (dut), RZ1032 (2) can have as much as 14 % uracil substituted for thymine and is used in site directed mutagenesis (3) where a deaminated cytosine residue is to be preserved or the uracil containing DNA template is to be destroyed (1,2,3). Since the complete nucleotide sequence of ung (w.t.) has recently been described (4), it was of interest to define the mutations in the ung gene of these strains and explain the molecular mechanisms that render them ung. 11 ofApproximately 1.0 jig of chromosomal DNA from different strains o2 of E. coli were mixed with 0.1 nmole of 5'- sense MN 3 (GCAGTTAAGCTAGGCGGATTG) and 3'- antisense (TGCCATCCGGCATTTCCCC