Add to ORKGNote that since miRNAs differing in only a few bases are expected to crosshybridize, only one miRNA per multicopy group was tested. Figure S2. Sequence Alignments for the Six Predicted miR-2 Family Target Sites in the 3′UTRs of the Proapoptotic Factors hid, grim, rpr, and skl. rpr rpr201_vir----CCCCUAAGUUUACUCAUCAAAGCGAUUGUGAUAAUGGUUUUGUUUCUUUCGAUAU rpr201_pse UUUUUUUUUUAGUUUAAUCAUCAAAGCGAUUGUGAUAAUGGUUUUGUUUCUA-CGAAAA rpr201_ana CAAAAUUUUUAGUUUACUCAUCAAAGCGAUUGUGAUAAUGGUUUUGUUUCUA-AAAAAA rpr201_yak ACCCACUUUUAGUUUACUCAUCAAAGCGAUUGUGAUAAUGGUUUUGUUUCUA-CGAAAA rpr201_mel ACCCAAUUUUAGUUUACUCAUCAAAGCGAUUGUGAUAAUGGUUUUGUUUCUA-CAAAAA 98765432
<p>(<b>A</b>) Cartoon of <i>Drosophila</i> Hox complex showing locations of miRNA hairpins. Unlabele...
Motivation: MicroRNAs are a class of endogenous small RNAs that play regulatory roles. Intergenic mi...
<div><p>MicroRNAs (miRNAs) are short RNA molecules that regulate gene expression by binding to targe...
<div><p>(A) Diagrams of 3′ UTR conservation in six drosophilid genomes (horizontal black bars) and t...
Table S3. The 91 seed families broadly conserved in Drosophila species, listing for each family the ...
<div><p>(A) Conservation of sequences in the 3′ UTRs of <i>reaper</i>, <i>grim</i>, and <i>sickle</i...
<p>Overlapping miRNA genes (<i>hsa-mir-3618</i> and <i>mir-1306</i>, <i>mir-3173</i>, and <i>mir-593...
MicroRNAs (miRNAs) are short RNA molecules that regulate gene expression by binding to target messen...
<p>Nucleotide sequence conservation between the 3′ UTRs of human and the closest mouse or rat orthol...
<p>The cleavage sites of two selected targets in two miRNA as identified by 5′ RACE analysis. For ea...
MicroRNA (miRNA) is small regulatory non-coding single stranded RNA molecule that can repress protei...
<p>Targeting specificity of recently evolved <i>MIRNA</i>s. Two target prediction scores are shown f...
<p>A) miR-25 and miR-32, two miRNAs with identical seed regions (upper-case letters), have 81% overl...
<div><p>(A) Comparison of sequence conservation in the 3′ UTRs of miRNA target genes. For <i>lin-14<...
<p>(A) T-plot (top) and miRNA: mRNA alignments (bottom) for two category I targets, Unigene11776_All...
<p>(<b>A</b>) Cartoon of <i>Drosophila</i> Hox complex showing locations of miRNA hairpins. Unlabele...
Motivation: MicroRNAs are a class of endogenous small RNAs that play regulatory roles. Intergenic mi...
<div><p>MicroRNAs (miRNAs) are short RNA molecules that regulate gene expression by binding to targe...
<div><p>(A) Diagrams of 3′ UTR conservation in six drosophilid genomes (horizontal black bars) and t...
Table S3. The 91 seed families broadly conserved in Drosophila species, listing for each family the ...
<div><p>(A) Conservation of sequences in the 3′ UTRs of <i>reaper</i>, <i>grim</i>, and <i>sickle</i...
<p>Overlapping miRNA genes (<i>hsa-mir-3618</i> and <i>mir-1306</i>, <i>mir-3173</i>, and <i>mir-593...
MicroRNAs (miRNAs) are short RNA molecules that regulate gene expression by binding to target messen...
<p>Nucleotide sequence conservation between the 3′ UTRs of human and the closest mouse or rat orthol...
<p>The cleavage sites of two selected targets in two miRNA as identified by 5′ RACE analysis. For ea...
MicroRNA (miRNA) is small regulatory non-coding single stranded RNA molecule that can repress protei...
<p>Targeting specificity of recently evolved <i>MIRNA</i>s. Two target prediction scores are shown f...
<p>A) miR-25 and miR-32, two miRNAs with identical seed regions (upper-case letters), have 81% overl...
<div><p>(A) Comparison of sequence conservation in the 3′ UTRs of miRNA target genes. For <i>lin-14<...
<p>(A) T-plot (top) and miRNA: mRNA alignments (bottom) for two category I targets, Unigene11776_All...
<p>(<b>A</b>) Cartoon of <i>Drosophila</i> Hox complex showing locations of miRNA hairpins. Unlabele...
Motivation: MicroRNAs are a class of endogenous small RNAs that play regulatory roles. Intergenic mi...
<div><p>MicroRNAs (miRNAs) are short RNA molecules that regulate gene expression by binding to targe...