Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk. Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, to reduce fat in the sample to 0.2 % w/v, which is the lowest limit for detection in the Gerber method, to avoid the polymerization. The raw milk samples were analyzed by using the traditional gold standard method for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize the Listeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer sets were use: L1 (CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) that recognize the hlyA gene...
Conventional methods for the detection of Listeria in foodstuffs are generally cumbersome and time c...
Based on comparative analysis of 16S rRNA gene sequences, two oligonucleotide probes for in situ det...
Listeria monocytogenes strains, isolated from various sources (food, environment, and animals), were...
A method previously developed for direct (non-enrichment) detection of Escherichia coli O157:H7 was ...
The aim of our work was to evaluate a new commercial test kit for the detection of Listeria monocyto...
Primers of iap gene were used as a target to develop a PCR technique for detecting Listeria monocyto...
Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytog...
Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed b...
Listeria monocytogenes was discovered as a source of contamination during sampling of raw milk and i...
Aims: A rapid and sensitive method for Listeria Monocytogenes direct detection from milk was develop...
Listeria monocytogenes, prouzrokovač listerioze kod ljudi i životinja, je fakultativan intraćelijski...
The aim of this study was to follow the contamination of food with Listeria monocytogenes by using S...
Objetivo. Validar un método para la detección directa de L. monocytogenes en leche cruda. Materiales...
The incidence of outbreaks of foodborne listeriosis has indicated the need for a reliable and rapid ...
none4There is a growing movement among consumers in the US and Europe towards minimally processed fo...
Conventional methods for the detection of Listeria in foodstuffs are generally cumbersome and time c...
Based on comparative analysis of 16S rRNA gene sequences, two oligonucleotide probes for in situ det...
Listeria monocytogenes strains, isolated from various sources (food, environment, and animals), were...
A method previously developed for direct (non-enrichment) detection of Escherichia coli O157:H7 was ...
The aim of our work was to evaluate a new commercial test kit for the detection of Listeria monocyto...
Primers of iap gene were used as a target to develop a PCR technique for detecting Listeria monocyto...
Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytog...
Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed b...
Listeria monocytogenes was discovered as a source of contamination during sampling of raw milk and i...
Aims: A rapid and sensitive method for Listeria Monocytogenes direct detection from milk was develop...
Listeria monocytogenes, prouzrokovač listerioze kod ljudi i životinja, je fakultativan intraćelijski...
The aim of this study was to follow the contamination of food with Listeria monocytogenes by using S...
Objetivo. Validar un método para la detección directa de L. monocytogenes en leche cruda. Materiales...
The incidence of outbreaks of foodborne listeriosis has indicated the need for a reliable and rapid ...
none4There is a growing movement among consumers in the US and Europe towards minimally processed fo...
Conventional methods for the detection of Listeria in foodstuffs are generally cumbersome and time c...
Based on comparative analysis of 16S rRNA gene sequences, two oligonucleotide probes for in situ det...
Listeria monocytogenes strains, isolated from various sources (food, environment, and animals), were...