Add to ORKG1 What is DotKnot? DotKnot is a heuristic method for pseudoknot prediction in a given RNA sequence. DotKnot extracts stems from the secondary structure probability dot plot calculated by RNAfold1. H-type pseudoknots and kissing hairpins are constructed and their presence in the sequence is verified. The predicted pseudoknots can then be further analysed using bioinformatics or laboratory techniques. Input sequence 5 ′ 3′GCUUCCAGGAUACCGGUUGCUAAGGAUCACCAAGCUUCGC dot.p
Background: Improving accuracy and efficiency of computational methods that predict...
We present TT2NE, a new algorithm to predict RNA secondary structures with pseudoknots. The method i...
It is of great signicance to develop an ecient software system for higher-level structural predictio...
RNA pseudoknots are functional structure elements with key roles in viral and cellular processes. Pr...
M. Reidys C, W. D. Huang F, E. Andersen J, C. Penner R, F. Stadler P, Nebel M. Topology and predicti...
Motivation: RNA H-type pseudoknots are ubiquitous pseudoknots that are found in almost all classes o...
Motivation: RNA H-type pseudoknots are ubiquitous pseudoknots that are found in almost all classes o...
The secondary structure of an RNA molecule is known to be critical in its biological function. Howev...
Most ab initio pseudoknot predicting methods pro-vide very few folding scenarios for a given RNA seq...
We present HotKnots, a new heuristic algorithm for the prediction of RNA secondary structures includ...
International audienceThe computational prediction of RNA secondary structure by free energy minimiz...
Pseudoknots are a special kind of RNA structures that play functional roles in a wide variety of bio...
Motivation: Pseudoknots have generally been excluded from the prediction of RNA secondary structures...
International audienceSeveral algorithms and methods have been developed for RNA secondary structure...
Obtaining valuable clues for noncoding RNA (ribonucleic acid) subsequences remains a significant cha...
Background: Improving accuracy and efficiency of computational methods that predict...
We present TT2NE, a new algorithm to predict RNA secondary structures with pseudoknots. The method i...
It is of great signicance to develop an ecient software system for higher-level structural predictio...
RNA pseudoknots are functional structure elements with key roles in viral and cellular processes. Pr...
M. Reidys C, W. D. Huang F, E. Andersen J, C. Penner R, F. Stadler P, Nebel M. Topology and predicti...
Motivation: RNA H-type pseudoknots are ubiquitous pseudoknots that are found in almost all classes o...
Motivation: RNA H-type pseudoknots are ubiquitous pseudoknots that are found in almost all classes o...
The secondary structure of an RNA molecule is known to be critical in its biological function. Howev...
Most ab initio pseudoknot predicting methods pro-vide very few folding scenarios for a given RNA seq...
We present HotKnots, a new heuristic algorithm for the prediction of RNA secondary structures includ...
International audienceThe computational prediction of RNA secondary structure by free energy minimiz...
Pseudoknots are a special kind of RNA structures that play functional roles in a wide variety of bio...
Motivation: Pseudoknots have generally been excluded from the prediction of RNA secondary structures...
International audienceSeveral algorithms and methods have been developed for RNA secondary structure...
Obtaining valuable clues for noncoding RNA (ribonucleic acid) subsequences remains a significant cha...
Background: Improving accuracy and efficiency of computational methods that predict...
We present TT2NE, a new algorithm to predict RNA secondary structures with pseudoknots. The method i...
It is of great signicance to develop an ecient software system for higher-level structural predictio...